A method for the detection of discontinuous RNA G-quadruplexes

A non-continuous, quadruplex technology, applied in the biological field, can solve the problem that the detection method needs to be improved

Active Publication Date: 2020-05-22
INST OF CHEM CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, current methods for the detection of discontinuous RNA G-quadruplexes still need to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for the detection of discontinuous RNA G-quadruplexes
  • A method for the detection of discontinuous RNA G-quadruplexes
  • A method for the detection of discontinuous RNA G-quadruplexes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 prepares sample

[0038] The samples used in the following examples are as follows:

[0039] Sample 1: non-continuous RNA G-quadruplex sample, the non-continuous RNAG-quadruplex used in the following examples are Spinach (SEQ ID NO:1), Bulges (SEQ ID NO:2), tRNA- Ala (SEQ ID NO:3) and tRNA-Cys (SEQ ID NO:4).

[0040] Nucleotide sequence shown:

[0041] GCAGCCGGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUCGACGCGACCGAAUGAAAUGGUGAAGGACGGGUCCAGCCGGCUGC (SEQ ID NO: 1).

[0042] UUGUGGUGGGUGGGUGGGU (SEQ ID NO:2).

[0043] GGG GGUGUAGCUCAGUGGUAGAGCGCGUGC (SEQ ID NO: 3).

[0044] GGGGUAUAGCUCAGUGGUAGAGCAUUUGA (SEQ ID NO: 4).

[0045] All nucleotide sequences were synthesized by Guangzhou Ruibo Biological Co., Ltd. Dissolve the sequence in Tris-HCl (with K + ) solution, the final concentration of the RNA solution (SEQ ID NO:1-4) is 20 micromole / liter, and after being heated to 90°C, and then naturally lowered to room temperature, samples 1, 2, 3 and 4 were obtained...

Embodiment 2

[0052] Example 2 Detection of non-continuous RNA G-quadruplex

[0053] 1. Preparation of reaction solution (solution A, solution B, solution C)

[0054] 1) Solution A

[0055] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 4 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of discontinuous RNA G-quadruplex to Thioflavin T is 2:1.

[0056] 2) Solution B

[0057] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 5 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T is 2:1.

[0058] 3) Solution C

[0059] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tris...

Embodiment 3

[0068] Example 3 Detection of non-continuous RNA G-quadruplex

[0069] 1. Preparation of reaction solution (solution A, solution B, solution C)

[0070] 1) Solution A

[0071] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 80 μL of 20 μmol / L sample 3 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of discontinuous RNA G-quadruplex to Thioflavin T was 2:1.

[0072] 2) Solution B

[0073] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 80 μL of 20 μmol / L sample 5 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T is 2:1.

[0074] 3) Solution C

[0075] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of thioflavin-T to preparation of a kit, a method for determining whether a discontinuous RNA G-quadruplex exists in a to-be-detected sample and a kit for detecting the discontinuous RNA G-quadruplex. The method for determining whether the discontinuous RNA G-quadruplex exists in the to-be-detected sample comprises the following steps: (1) the to-be-detected sample makes contact with thioflavin-T, a mixed solution is obtained, and the fact that the to-be-detected sample contains RNA is determined in advance; (2) fluorescence spectrum analysis is performed on the mixed solution; (3) whether the discontinuous RNA G-quadruplex exists in the to-be-detected sample is determined on the basis of a fluorescence spectrum analysis result. The method has the characteristics of being simple and convenient to operate and high in sensitivity and accuracy.

Description

technical field [0001] The present invention relates to the field of biotechnology. In particular, the present invention relates to methods for the detection of non-continuous RNA G-quadruplexes. More specifically, the present invention relates to the use of Thioflavin T in the preparation of a kit, a method for determining whether there is a non-continuous RNA G-quadruplex in a test sample, and a kit for detecting a non-continuous RNA G-quadruplex. Background technique [0002] The RNA G-quadruplex is a secondary structure formed by guanine-rich RNA sequences. The basic unit of the structure is a G-tetrad planar structure formed by three or four guanine bases through Hoogsteen hydrogen bonds. In the presence of cations (such as potassium ions or sodium ions), a unique parallel-structured G-quadruplex is formed through the stacking of multiple G planes. In the study of human transcriptional genes, it was found that many genes closely related to the occurrence and developme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6486G01N2021/6417
Inventor唐亚林许淑娟李骞
OwnerINST OF CHEM CHINESE ACAD OF SCI