A method for the detection of discontinuous RNA G-quadruplexes
A non-continuous, quadruplex technology, applied in the biological field, can solve the problem that the detection method needs to be improved
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 prepares sample
[0038] The samples used in the following examples are as follows:
[0039] Sample 1: non-continuous RNA G-quadruplex sample, the non-continuous RNAG-quadruplex used in the following examples are Spinach (SEQ ID NO:1), Bulges (SEQ ID NO:2), tRNA- Ala (SEQ ID NO:3) and tRNA-Cys (SEQ ID NO:4).
[0040] Nucleotide sequence shown:
[0041] GCAGCCGGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUCGACGCGACCGAAUGAAAUGGUGAAGGACGGGUCCAGCCGGCUGC (SEQ ID NO: 1).
[0042] UUGUGGUGGGUGGGUGGGU (SEQ ID NO:2).
[0043] GGG GGUGUAGCUCAGUGGUAGAGCGCGUGC (SEQ ID NO: 3).
[0044] GGGGUAUAGCUCAGUGGUAGAGCAUUUGA (SEQ ID NO: 4).
[0045] All nucleotide sequences were synthesized by Guangzhou Ruibo Biological Co., Ltd. Dissolve the sequence in Tris-HCl (with K + ) solution, the final concentration of the RNA solution (SEQ ID NO:1-4) is 20 micromole / liter, and after being heated to 90°C, and then naturally lowered to room temperature, samples 1, 2, 3 and 4 were obtained...
Embodiment 2
[0052] Example 2 Detection of non-continuous RNA G-quadruplex
[0053] 1. Preparation of reaction solution (solution A, solution B, solution C)
[0054] 1) Solution A
[0055] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 4 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of discontinuous RNA G-quadruplex to Thioflavin T is 2:1.
[0056] 2) Solution B
[0057] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 5 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T is 2:1.
[0058] 3) Solution C
[0059] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tris...
Embodiment 3
[0068] Example 3 Detection of non-continuous RNA G-quadruplex
[0069] 1. Preparation of reaction solution (solution A, solution B, solution C)
[0070] 1) Solution A
[0071] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 80 μL of 20 μmol / L sample 3 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of discontinuous RNA G-quadruplex to Thioflavin T was 2:1.
[0072] 2) Solution B
[0073] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 80 μL of 20 μmol / L sample 5 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T is 2:1.
[0074] 3) Solution C
[0075] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tri...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


