Check patentability & draft patents in minutes with Patsnap Eureka AI!

Positive reference taking GG type of 1510 site of human ALDH2*2 gene as template

A reference product, gene technology, applied in the field of molecular biology, to achieve the effect of solving the problem of quality inspection

Inactive Publication Date: 2017-11-07
TOYO TOYOBO CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a positive reference product with the GG type at the 1510 site of the human ALDH2*2 gene as a template, which is used to verify whether the test result of the GG type at the 1510 site of the human ALDH2*2 gene is accurate. , solved the quality detection problem of human ALDH2*2 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Positive reference taking GG type of 1510 site of human ALDH2*2 gene as template
  • Positive reference taking GG type of 1510 site of human ALDH2*2 gene as template
  • Positive reference taking GG type of 1510 site of human ALDH2*2 gene as template

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] Example: A positive reference product using the GG type at site 1510 of the human ALDH2*2 gene as a template

[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains the human ALDH2*2 gene fragment, and the human ALDH2*2 gene fragment is 5'-GAGCCCAGTCACCCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACT G AAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAGGGCTGCTGGTGGCTCGGAGCCT-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 1510 site of the human ALDH2*2 gene, and the 1510 site is used to characterize the GG of the human ALDH2*2 gene The position where type AA can be mutated into type AA of the human ALDH2*2 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.

[0022] Type AA positive reference substance is a reagent with a base sequence as the main component. The b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a positive reference taking a GG type of a 1510 site of a human ALDH2*2 gene as a template. The positive reference is characterized in that the positive reference is a reagent mainly comprising a base sequence. The base sequence comprises a human ALDH2*D gene fragment which is as shown in SEQ NO:4, wherein the base site with an underline is the 1510 site of the human ALDH2*D gene, and the 1510 site is used for representing a position wherein the GG type of the human ALDH2*D gene can be mutated to an AA type of the human ALDH2*D gene. The positive reference provided by the invention is used for verifying whether the detection result that a detected sample whether contains the GG type of the 1510 site of the human ALDH2*D gene or not is correct or not, and solves the quality detection problem of the human ALDH2*D gene.

Description

technical field [0001] The present invention relates to the technical field of molecular biology, in particular to a positive reference product using the GG type at the 1510 site of the human ALDH2*2 gene as a template. The positive reference product is used to verify that the ALDH2*2 genotype detection kit is applied to samples Auxiliary judgment of whether the sample is positive or not during the test. Background technique [0002] Quality control substances refer to quality control substances used in in vitro diagnostics, which have target detection substances with known concentrations, and are necessary products to make people believe that the quality of a certain product or service can meet the specified quality requirements. The purpose of quality control is to verify the accuracy, effectiveness and specificity of the entire PCR reaction process, and to monitor the status of the detection system. After the instrument is officially put into use, it should be calibrated...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6827C12Q2545/113
Inventor 孙茜
Owner TOYO TOYOBO CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More