A sybr GreenⅠ fluorescent quantitative PCR kit for detecting Salmonella pullorum and its application

A Salmonella, fluorescent quantitative technology, applied in the field of biotechnology detection, to achieve the effect of simple operation, prevention of mistaken elimination, and high sensitivity

Active Publication Date: 2021-02-12
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems that Salmonella pullorum is prone to occur in the detection process, the purpose of the present invention is to provide a rapid and specific fluorescent quantitative PCR kit and detection method for detecting Salmonella pullorum, which can not only distinguish other common pathogens Pathogenic Salmonella serotypes and common non-Salmonella pathogenic bacteria, and can well distinguish Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sybr GreenⅠ fluorescent quantitative PCR kit for detecting Salmonella pullorum and its application
  • A sybr GreenⅠ fluorescent quantitative PCR kit for detecting Salmonella pullorum and its application
  • A sybr GreenⅠ fluorescent quantitative PCR kit for detecting Salmonella pullorum and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Primer Design

[0038] A comprehensive bioinformatics analysis was performed on the whole genome of pullorum, typhoid and Salmonella enteritidis serotypes in GenBank, and finally the SEEP17695 gene (shown in SEQ ID NO.1) was determined as the detection target gene of pullorum pullorum.

[0039] According to the SEEP17695 gene, specific primers were designed using Oligo 6 software, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequences are as follows:

[0040] SEEP17695-idF10: 5'TCTAGCACTGAACTTGGCGA 3' (shown in SEQ ID NO.2);

[0041] SEEP17695-idR10: 5'TGTGTCGCCATTGTAGGTCA 3' (shown in SEQ ID NO.3).

Embodiment 2

[0042] Embodiment 2: the establishment of PCR detection method for Salmonella pullorum

[0043] 1. Experimental strains and reagents

[0044] The experimental strains are shown in Table 1, among which 13 isolates were isolated and identified by the Animal Bacteriosis Laboratory of Harbin Veterinary Research Institute.

[0045] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.

[0046] Table 1 Experimental strains

[0047]

[0048]

[0049] Note: ①: China Veterinary Microbiology Collection Management Center; ②: China Medical Bacteria Collection Management Center; ③: China Industrial Microbiology Culture Collection Management Center; ④: American Type Culture Collection; ⑤: Tiangen Biochemical Technology (Beijing) ) Co., Ltd.; ⑥: preserved in this room.

[0050] 2. Method

[0051] 2.1 Selection of the most suitable enrichment solution and template preparation method

[0052] Five different enrichment solutions were used to amplify Salmo...

Embodiment 3

[0078] Embodiment 3: artificial contamination sample detection

[0079] Artificially polluted chicken feces and chicken samples, using the fluorescent quantitative PCR method established in Example 2 to detect Salmonella pullorum, and at the same time using conventional bacterial isolation and identification methods to detect, and evaluate the method established in this study.

[0080] 1. Detection of artificially contaminated chicken feces samples

[0081] Fluorescent quantitative PCR method: Aseptically collect the feces of SPF chickens in the SPF level feeding environment, take 10g of feces and add them to 90mL SC enrichment solution, and cultivate overnight. Dilute the overnight culture of Salmonella pullorum pullorum with sterile water 10 times, and inoculate the appropriate dilution of the bacterial solution into the chicken manure mixture (10g feces + 90mL SC enrichment solution), so that the inoculation amount is 0cfu, 1 ~10cfu, 10~10 2 cfu, 10 2 ~10 3 cfu. Three ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SYBR Green I fluorescent quantitative PCR kit for detecting Salmonella pullorum and its application. Aiming at the specific fragment of Salmonella pullorum, the present invention designs a primer for specifically amplifying Salmonella pullorum, and establishes a fluorescent quantitative PCR detection method capable of directly detecting Salmonella pullorum from feces and chicken samples , the method has good specificity, high sensitivity, and short detection time, and can quickly and accurately detect Salmonella pullorum, and the amplification results of 22 other common pathogenic Salmonella serotypes and 8 common non-Salmonella pathogenic bacteria are all the same. Negative, and can distinguish Escherichia coli very well. The proposal of the present invention provides a fast and effective technical means for the detection of Salmonella pullorum, and the method is simple to operate, has low requirements for equipment, and has a short detection time, which can satisfy most poultry farms for rapid detection of Salmonella pullorum demand.

Description

technical field [0001] The invention relates to a fluorescent quantitative PCR kit for detecting Salmonella pullorum, and also relates to a fluorescent quantitative PCR detection method for rapidly detecting Salmonella pullorum using the kit. The invention belongs to the field of biotechnology detection. Background technique [0002] Salmonella (Salmonella) is one of the main food-borne pathogens, and its serotypes are numerous. There are more than 2,600 serotypes that have been identified, but only some specific Salmonella serotypes can infect humans and animals. Among them, Salmonella pullorum (S.pullorum) is a host-specific pathogen that seriously affects the development of my country's poultry breeding industry. It has a wide range of transmission and strong pathogenicity. It mainly infects chicks within 21 days of age and can cause white diarrhea. The mortality rate after infection is almost 100%. However, adult chickens usually have no clinical symptoms after being infe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11C12R1/42
CPCC12Q1/686C12Q1/689C12Q2563/107C12Q2545/114
Inventor于申业刘思国曹俊
OwnerHARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI