Inhibitor of b12 protein expression and its application in tuberculosis immunity and treatment
A protein expression and inhibitor technology, applied in the field of bioengineering, can solve the problem of no miR-16 targeting B12
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1. The expression of B12 in T cells of pulmonary tuberculosis patients is up-regulated and correlated with clinical classification
[0031] 1. PBMC separation
[0032] Collect peripheral venous blood from tuberculosis patients and healthy subjects, add lymphocyte separation medium with the same volume as the blood sample; centrifuge horizontally at 1200rpm for 20min at room temperature; carefully draw the second layer of white lymphocyte layer into another sterile centrifuge tube, and use 10mL Resuspend in sterile PBS buffer and wash 3 times, centrifuge at room temperature and 1200rpm for 10 min, discard the supernatant; suspend the cells with the remaining PBS buffer (about 200 μl) in the centrifuge tube to obtain a peripheral blood mononuclear cell (PBMC) suspension for later use.
[0033] 2. Cell staining
[0034]Transfer PBMCs to 5mL flow tubes, add 2mL 2% FBS-PBS, centrifuge at 1500rpm for 5min, discard the supernatant, add CD3 and B12 antibodies to mix, i...
Embodiment 2
[0038] Embodiment 2, pulmonary tuberculosis patient B12 + Downregulation of CD272 expression in T cells
[0039] In order to further explore the effect of high B12 expression on T cells, on the basis of Example 1, flow cytometry was used to detect B12 in tuberculosis patients and healthy subjects + The expression level of CD272 in T cells, the results are as follows figure 2 As shown, the content of CDC272 in B12+ T cells of tuberculosis patients was significantly lower than that of HV volunteers (P<0.05). This shows that B12+ T cells in patients with pulmonary tuberculosis have weakened immune memory of tuberculosis infection, thereby leading to immune tolerance of MTB; combined with the results of Example 1, it can be predicted that it is expected to reduce the activity of B12 protein by preparing substances that inhibit the expression of B12 protein or The inactivated substance, the substance that promotes the degradation of B12 protein, is used to enhance the immunity o...
Embodiment 3
[0040] Example 3. Dual-luciferase reporter verification of miR-16 targeting B12
[0041] Surprisingly, it was found in the study that the relative expression of miR-16 was negatively correlated with the relative expression of B12 mRNA in tuberculosis patients. The present invention further verified the relationship of miR-16 targeting B12 through a dual luciferase reporter.
[0042] 1. Construction of B12-3'-UTR and B12-mutant-3'-UTR recombinant plasmids
[0043] Cloning the base sequence encoding B12-3'-UTR into the downstream of the carrier luciferase gene to construct a B12-3'-UTR recombinant plasmid, the base sequence encoding B12-3'-UTR is:
[0044] 5'-ACCAGTCTACCCATCGCGACTGACCAGACCCTCAGGGAGTCAGGGCACGGGAGGCCCTATCTCCCATCCTGTGGAACCCGCCCCATTGGCCACCCCATGCTGCTGCTGCCTGGGTCTCTGCTCTAGCACCCAGAGGCATGACAGGCCCTGCTCAGAGGTCAGAGGGTCTGGGCAGAGGAGGGACCACATTCCCCTGCCTTGCCCCTG-3';
[0045] Cloning the mutated base sequence encoding B12-3'-UTR into the downstream of the carrier luciferase gen...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com