Inhibitor of b12 protein expression and its application in tuberculosis immunity and treatment

A protein expression and inhibitor technology, applied in the field of bioengineering, can solve the problem of no miR-16 targeting B12

Active Publication Date: 2020-06-30
GUANGDONG MEDICAL UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report that miR-16 targets B12 to participate in tuberculosis immunity and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inhibitor of b12 protein expression and its application in tuberculosis immunity and treatment
  • Inhibitor of b12 protein expression and its application in tuberculosis immunity and treatment
  • Inhibitor of b12 protein expression and its application in tuberculosis immunity and treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1. The expression of B12 in T cells of pulmonary tuberculosis patients is up-regulated and correlated with clinical classification

[0031] 1. PBMC separation

[0032] Collect peripheral venous blood from tuberculosis patients and healthy subjects, add lymphocyte separation medium with the same volume as the blood sample; centrifuge horizontally at 1200rpm for 20min at room temperature; carefully draw the second layer of white lymphocyte layer into another sterile centrifuge tube, and use 10mL Resuspend in sterile PBS buffer and wash 3 times, centrifuge at room temperature and 1200rpm for 10 min, discard the supernatant; suspend the cells with the remaining PBS buffer (about 200 μl) in the centrifuge tube to obtain a peripheral blood mononuclear cell (PBMC) suspension for later use.

[0033] 2. Cell staining

[0034]Transfer PBMCs to 5mL flow tubes, add 2mL 2% FBS-PBS, centrifuge at 1500rpm for 5min, discard the supernatant, add CD3 and B12 antibodies to mix, i...

Embodiment 2

[0038] Embodiment 2, pulmonary tuberculosis patient B12 + Downregulation of CD272 expression in T cells

[0039] In order to further explore the effect of high B12 expression on T cells, on the basis of Example 1, flow cytometry was used to detect B12 in tuberculosis patients and healthy subjects + The expression level of CD272 in T cells, the results are as follows figure 2 As shown, the content of CDC272 in B12+ T cells of tuberculosis patients was significantly lower than that of HV volunteers (P<0.05). This shows that B12+ T cells in patients with pulmonary tuberculosis have weakened immune memory of tuberculosis infection, thereby leading to immune tolerance of MTB; combined with the results of Example 1, it can be predicted that it is expected to reduce the activity of B12 protein by preparing substances that inhibit the expression of B12 protein or The inactivated substance, the substance that promotes the degradation of B12 protein, is used to enhance the immunity o...

Embodiment 3

[0040] Example 3. Dual-luciferase reporter verification of miR-16 targeting B12

[0041] Surprisingly, it was found in the study that the relative expression of miR-16 was negatively correlated with the relative expression of B12 mRNA in tuberculosis patients. The present invention further verified the relationship of miR-16 targeting B12 through a dual luciferase reporter.

[0042] 1. Construction of B12-3'-UTR and B12-mutant-3'-UTR recombinant plasmids

[0043] Cloning the base sequence encoding B12-3'-UTR into the downstream of the carrier luciferase gene to construct a B12-3'-UTR recombinant plasmid, the base sequence encoding B12-3'-UTR is:

[0044] 5'-ACCAGTCTACCCATCGCGACTGACCAGACCCTCAGGGAGTCAGGGCACGGGAGGCCCTATCTCCCATCCTGTGGAACCCGCCCCATTGGCCACCCCATGCTGCTGCTGCCTGGGTCTCTGCTCTAGCACCCAGAGGCATGACAGGCCCTGCTCAGAGGTCAGAGGGTCTGGGCAGAGGAGGGACCACATTCCCCTGCCTTGCCCCTG-3';

[0045] Cloning the mutated base sequence encoding B12-3'-UTR into the downstream of the carrier luciferase gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a protein B12 expression inhibitor and an application thereof in immunization and treatment of TB (tuberculosis). B12 can mediate the immune process of TB and may weaken immunememory of TB infection through CD272 to cause immune tolerance of MTB (mycobacterium tuberculosis). Therefore, a substance for inhibiting expression of B12 protein, a substance for reducing activityof the protein B12 or inactivating the protein B12, or a substance for promoting degradation of the protein B12 is expected to be prepared to enhance immunity of a patient with TB and achieve the TB treating effect. Besides, studies show that miR-16 can target B12, and a lentivirus containing the gene miR-16 can reduce expression of B12 in T lymphocytes of the patient with TB, so, miR-16 can be applied to preparation of the protein B12 expression inhibitor.

Description

technical field [0001] The invention belongs to the field of bioengineering, and more specifically relates to a B12 protein expression inhibitor and its application in tuberculosis immunity and treatment. Background technique [0002] According to statistics, one-third of the world's population is infected with Mycobacterium tuberculosis (MTB), and about 5% to 10% of infected people develop tuberculosis (Tuberculosis, TB). Tuberculosis is a public health problem that threatens global human health. There are about 9 million new tuberculosis patients in the world every year, and about 1.5 million of them die. At present, there are few studies on the pathogenesis, prognosis and prognosis of tuberculosis. Existing studies have shown that MTB-infected patients will have MTB-mediated immune cell function weakening or functional limitation. If MTB cannot be completely cleared, tuberculous granulomas will form and develop into MTB latent infection patients with low body immunity. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61K31/7105A61K48/00A61P31/06A61P37/04
Inventor 曾今诚林东子林碧华袁耀钦周克元张海涛刘新光黄明元刘乾坤梅月志
Owner GUANGDONG MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap