Single-domain antibody capable of recognizing HLA-A2/RMFPNAPYL

A technology of HLA-A2 and single-domain antibody, applied in the field of single-domain antibody that recognizes HLA-A2/RMFPNAPYL, can solve the problem of lack of literature

Active Publication Date: 2018-02-16
SHENZHEN BEIKE BIOTECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Most of the generated MAR molecules reported in the literature are essentially limited to specific recognition of MHC complexes at the cellular level or to be used to infer these complexes, with little literature demonstrating their practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-domain antibody capable of recognizing HLA-A2/RMFPNAPYL
  • Single-domain antibody capable of recognizing HLA-A2/RMFPNAPYL
  • Single-domain antibody capable of recognizing HLA-A2/RMFPNAPYL

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Screening single domain antibodies of HLA-A2 / RMFPNAPYL complex

[0052] 1.1 Preparation of single-domain antibody phage library

[0053] 1.1.1 Preparation of helper phage (BM13)

[0054] The M13KE phage replicon was double digested with AlwnI and AfeI, and the synthetic gene fragment was also double digested with AlwnI and AfeI, and then ligated together with T4 ligase. After ligation, TG1 was transfected to obtain helper phage BM13. Thus, in the original replicator

[0055] The tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct sequence was replaced by a synthetic gene sequence, that is, a trypsin cleavage sequence was added to the phage GIII coding region. Once used as a helper phage, a trypsin digestion step was added to reduce the number of phages that did not contain the fusion target gene protein.

[0056] The synthetic gene sequence is as follows:

[0057] CCA GCC GGC CTT TCT GAG GGG TCG ACT ATA GAA G...

Embodiment 2

[0102] Example 2. Expression of single domain antibody

[0103] Prokaryotic single domain antibody expression

[0104] The four single-domain antibody genes were cloned into pET22b with Nco I and Not I restriction enzymes before and after, respectively, to express the monovalent antibody. The constructed vector was transformed into E.coli / DE3, single clone was picked the next day, shaken at 37°C 220rpm and cultured to an OD600 of about 0.5, after adding IPTG (working concentration of 1mM), induced expression at 18°C ​​220rpm for 20h. Detection of protein expression. The sonicated supernatant was purified with ProteinA and then run SDS-PAG, see Figure 4 . Among them, Marker's strips are 14, 25, 30, 40, 50, 70, 100, 120, 160KD from small to large. Line1 is M5-H1, line2 is M5-G3, and line3 is M5-F4. Single domain antibodies are about 14KD in size.

[0105] Expression of FC fusion in pET22b In order to form a diabody, the single domain antibody gene was linked to human FC t...

Embodiment 3

[0112] Example 3. Specific recognition of HLA-A2 / RMFPNAPYL complex by single domain antibody

[0113] Specific Recognition of Antigen Complexes by Single Domain Antibodies

[0114] The single-domain antibody expressed on pET22b was collected, resuspended in PBS, and then sonicated. Ultrasonication conditions: 600W, ultrasonic for 2 seconds, interval of 6 seconds, 10 minutes in total, 16°C. After sonication, centrifuge at 12,000 rpm at 4°C for 10 minutes, take the supernatant for ELISA identification of the specificity of different antigens (Protein A-HRP is the secondary antibody) and read the plate. For data analysis, see Figure 9 . Among them, the ordinate is the light absorption value at 650 nm, and the abscissas 1, 2, 3, and 4 are the four antigens HLA-A2 / ITDQVPFSV, HLA-A2 / NLVPMVATV, HLA-A2 / RMFPNAPYL, HLA-A2 / SLLMWITQC. Three samples were sonicated supernatants of M5-H1, M5-G3, M5-F4 expressed in pET22b alone.

[0115] The results showed that the single-domain antibody...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Affinity constantaaaaaaaaaa
Affinity constantaaaaaaaaaa
Login to View More

Abstract

The invention discloses a single-domain antibody capable of recognizing HLA-A2 / RMFPNAPYL and CDR1, CDR2, and CDR3 sequences having a specific recognition effect. A fusion protein is characterized by being prepared by abovementioned amino acid sequences and at least one polypeptide having a recognition function. A multi-specific or multifunctional molecule comprises the single-domain antibody. A nucleic acid molecule encodes the polypeptide molecule. A carrier comprises the nucleic acid sequence. The nucleotide sequence or at least part of sequence of a protein expressed by the nucleic acid molecule can be expressed by a proper expression system so as to obtain a corresponding protein or polypeptide. A host cell comprises a nucleic acid sequence that expresses the abovementioned protein. The single-domain antibody can recognize an artificially synthesized HLA-A2 / RMFPNAPYL compound, can be combined with a HLA-A2 / RMFPNAPYL compound that is expressed on the surface of tumor cells and is prepared from natural antigen, and can be used to develop a product for treating related tumors.

Description

technical field [0001] The invention belongs to the technical field of antibodies, in particular to a single-domain antibody that recognizes HLA-A2 / RMFPNAPYL and its application. Background technique [0002] Wilms tumor gene (WT1) was discovered and cloned in Wilms tumor in 1990 by Call, Bonetta, Gessler and other three research groups using different methods. The gene is located on human chromosome 11p13, expressed in normal tissues, and expressed in various highly expressed in tumors. Studies have shown that WT1 is a multifunctional transcriptional regulator that can regulate growth factors and receptors related to growth and differentiation, such as insulin-like growth factors (IGFs), insulin-like growth factor 1 receptor (IGF1R), platelet-derived growth factor A (PDGFA), epidermal growth factor (EGF), monocyte-macrophage colony-stimulating factor (M-CSF), multidrug resistance gene 1 (MDR1), etc., WT1 produces a variety of biological effects by affecting its transcripti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/46A61P35/00
CPCC07K16/18C07K16/2803C07K16/2833C07K2317/31C07K2317/565C07K2317/569
Inventor古明珠高斌吕丽慧刘莹梁猛
OwnerSHENZHEN BEIKE BIOTECH