Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Arabidopsis u1a Gene in Improving Plant Salt Tolerance

A technology of transgenic plants, Arabidopsis, applied in the field of application of Arabidopsis U1A gene in improving plant salt tolerance, can solve the problems that the role of U1A gene has not been reported, and achieve huge economic benefit potential and broad application prospects Effect

Active Publication Date: 2020-01-10
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some genes that can significantly improve the salt tolerance of plants have been found, but there is no report about the role of U1A gene in the process of plant salt tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Arabidopsis u1a Gene in Improving Plant Salt Tolerance
  • Application of Arabidopsis u1a Gene in Improving Plant Salt Tolerance
  • Application of Arabidopsis u1a Gene in Improving Plant Salt Tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Cloning of Arabidopsis U1A gene

[0031] 1. Arabidopsis leaf cDNA synthesis: Extract total RNA from Arabidopsis leaves and reverse transcribe to obtain first-strand cDNA;

[0032] 2. PCR amplification of the U1A gene: using Arabidopsis thaliana leaf cDNA as a template, designing primers according to the sequence of the U1A gene, performing PCR amplification, recovering and purifying the PCR amplification products, and sequencing them. Primers are:

[0033] Forward primer:

[0034] 5'-AAAAAAGCAGGCTTCATGGAGATGCAAGAGGCT-3' (SEQ ID NO.3)

[0035] Reverse primer:

[0036] 5'-CAAGAAAGCTGGGTCTTTCTTGGCATACGTGAT-3' (SEQ ID NO.4)

[0037] The PCR reaction system and amplification conditions are shown in Table 1.

[0038] Table 1

[0039]

[0040] Sequencing was sent to Invitrogen for sequencing. The concrete operation of reclaiming and purifying PCR amplification product is as follows: gel electrophoresis (see figure 1 ), use a clean blade to cut off the gel ...

Embodiment 2

[0041] Example 2 Construction of recombinant expression vector and preparation method of transgenic plants

[0042] 1. Construction of recombinant expression vector

[0043]Primers were designed according to the Arabidopsis U1A gene sequence, and according to the BP reaction requirements in the Gateway system, a 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTGC3' sequence was added before the forward primer in Example 1 above, and a 5'GGGGACCACTTTGTACAAGAAAGCTGGGTC3 was added before the reverse primer in Example 1 above. 'sequence. PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning. These fragments were cloned into pDONR-207 vector (purchased from Thermo Fisher Scientific Co., Ltd.) by BP reaction, and then these fragments were respectively cloned into respective destination vectors by LR reaction.

[0044] use The principle of technology construction carrier can be briefly described as follows:

[0045]

[0046] BP response:

[0047] (1) Prepare 8 μl...

Embodiment 3

[0069] Example 3 Comparison of growth characteristics between salt stress mutants and wild type at different salt concentrations

[0070] Under the condition of salt stress, the Arabidopsis T-DNA insertion mutants obtained from the TAIR website (www.arabidopsis.org) were screened to obtain the salt stress-sensitive mutant Salk_074230 (Alonso, J.M., Stepanova, A.N., et al . Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657.), the mutant was named atu1a. The growth of wild-type plants and mutant plants on normal MS medium is the same, as shown in Figure 2, indicating that the gene mutation (T-DNA sequence inserted into the third exon of U1A gene leads to loss of U1A gene expression) will not affect the normal growth of plants. growth and development process. When the wild-type and mutant plants were grown on the MS medium containing 175mM sodium chloride, the growth of the mutant plants was smaller than that of the wild-type plants, see Figure ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of arabidopsis U1A gene to plant salt tolerance improvement. The nucleotide sequence of the arabidopsis salt tolerance gene U1A is shown as SEQ ID NO.1, and the amino acid sequence of the encoding protein is shown as SEQ ID NO.2. The condition that the arabidopsis U1A gene participates in the plant salt stress resistant biological process is proved for the firsttime; the arabidopsis U1A gene is applied to salt tolerance plant culture; good application prospects are realized in the technical field of salt tolerance breeding.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and particularly relates to an application of Arabidopsis thaliana U1A gene in improving salt tolerance of plants. Background technique [0002] Soil salinization is a global problem. A large amount of land has been salinized, and more land is in the process of salinization. Salt stress has become the most important factor affecting agricultural production worldwide. environmental stressors. Therefore, how to improve the salt tolerance of plants has become an important research direction for scientific researchers. Therefore, cloning plant salt-tolerant genes and using these genes to breed new salt-tolerant crop varieties is an important topic of current scientific research. [0003] Scientists have made great progress in the study of plant salt tolerance by using genetic engineering technology, and have cloned a large number of genes related to salt tolerance, and transferred these genes into...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/11A01H5/00A01H6/20
CPCC07K14/415C12N15/8273
Inventor 郑军王振宇
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com