Method used for high efficiency collecting of neural stem cells in vitro

A technology of neural stem cells and cells, applied in the field of cell biology, can solve problems such as strong subjectivity and achieve efficient results

Inactive Publication Date: 2018-03-23
NANKAI UNIV
View PDF4 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These three methods have a common disadvantage, that is, they require r

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method used for high efficiency collecting of neural stem cells in vitro
  • Method used for high efficiency collecting of neural stem cells in vitro

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Apparently, the described embodiments are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without creative efforts fall within the protection scope of the present invention.

[0033] 1. Plasmid construction

[0034] sgRNA1 and sgRNA2 (sgRNA1: CCCGGTGTGGATGCGGATAT; sgRNA2: AGGCCTCTTTTGGTATTCCA) were designed using the CRISPR design website (www.crispr.mit.edu) and cloned into the PX461 vector (Addgene). The specific method is to digest the PX461 vector with BbsI (Thermo), and then purify and recover the digested product. Phosphorylated annealing of oligonucleotides sgRNA1 and sgRNA2. The annealed oligonucleotides were ligated into the vector recovered ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of cytobiology, and more specifically relates to a method used for high efficiency collecting of neural stem cells in vitro. The method comprises followingsteps: A, an embryonic stem cell line containing Pax6-GFP reporting system is constructed through CRISPR/Cas9 system; B, the Pax6-GFP ES reporting system is used for guiding neural differentiation invitro and in vivo; C, the Pax6-GFP reporting system is used for enriching and purifying neural stem cells. According to the method, the CRISPR/Cas9 gene editing tool is adopted to construct the cellline containing the Pax6-GFP reporting system, and realize rapid high efficiency collecting of neural stem cells in vitro through the cell line.

Description

technical field [0001] The invention relates to the technical field of cell biology, in particular to a method for efficiently obtaining neural stem cells in vitro. Background technique [0002] Since the cause of some neurodegenerative diseases is the loss of certain neurons, stem cell therapy has great potential value in the treatment of such diseases, and neural stem cells are an indispensable part of it. How to quickly obtain neural stem cells in vitro is a problem that scientists have been exploring. There are three main methods for differentiating neural stem cells in vitro: EB suspension culture without directional differentiation into neural stem cells; co-culture of embryonic stem cells and specific stromal cells; monolayer adherent culture under specific growth factor conditions. These three methods have a common shortcoming, that is, the experience of the experimenter is required, and the operation is too subjective. Contents of the invention [0003] The purp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/90C12N9/22C12N5/10
CPCC12N5/0623C12N9/22C12N15/907
Inventor 帅领李艳妮李旭张文豪王海松
Owner NANKAI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap