Method used for high efficiency collecting of neural stem cells in vitro
A technology of neural stem cells and cells, applied in the field of cell biology, can solve problems such as strong subjectivity and achieve efficient results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Apparently, the described embodiments are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without creative efforts fall within the protection scope of the present invention.
[0033] 1. Plasmid construction
[0034] sgRNA1 and sgRNA2 (sgRNA1: CCCGGTGTGGATGCGGATAT; sgRNA2: AGGCCTCTTTTGGTATTCCA) were designed using the CRISPR design website (www.crispr.mit.edu) and cloned into the PX461 vector (Addgene). The specific method is to digest the PX461 vector with BbsI (Thermo), and then purify and recover the digested product. Phosphorylated annealing of oligonucleotides sgRNA1 and sgRNA2. The annealed oligonucleotides were ligated into the vector recovered ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

