A kind of preparation method of 3α-hydroxyl-7 oxo-5β-cholanic acid and its preparation enzyme 1

A technology of cholic acid and deoxycholic acid, applied in biochemical equipment and methods, oxidoreductases, enzymes, etc., can solve problems such as harsh conditions, long reaction time, and environmental pollution, and achieve mild and easy-to-control reaction conditions, The effect of high industrial application value, non-toxic and non-polluting cost

Active Publication Date: 2021-09-07
ZHONGSHAN BONTAC BIO TECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a new preparation method of 3α-hydroxyl-7 oxo-5β-cholanic acid to solve the problems of organic solvent residues, harsh conditions, Due to the disadvantages of long reaction time, cumbersome operation, high cost, and environmental pollution, the present invention also provides a biological enzyme suitable for the new preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of preparation method of 3α-hydroxyl-7 oxo-5β-cholanic acid and its preparation enzyme 1
  • A kind of preparation method of 3α-hydroxyl-7 oxo-5β-cholanic acid and its preparation enzyme 1
  • A kind of preparation method of 3α-hydroxyl-7 oxo-5β-cholanic acid and its preparation enzyme 1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Preparation of co-expression recombinant plasmid pET22b-AHSDH2-LDH containing parental gene

[0030]The 7α-steroid dehydrogenase gene AHSDH2 derived from Halomonas jeotgali sp. and the lactate dehydrogenase gene LDH derived from Weissella sp. were respectively used with the primer pair 5'CGCCATATGATGTACGACCCGAAGAACTT3' and 5' 'CCGGAATTCTTAGTGGTGGTGGTGGTGAT3' and the primer pair 5'CCGGAATTCAAGGAGATATACATATGAAGATCTTCGCGTACGGTA3' and 5'CCGCTCGAGTTAATATTCCCACCGCAATGC3' were obtained by PCR amplification technology and the PCR product was digested and inserted into the Nde I and EcoR I sites and the EcoRI site of the expression vector pET22b(+) at the same time and Xho I site to obtain the co-expression recombinant plasmid pET22b-AHSDH2-LDH. Through DNA sequencing, it is determined that the nucleotide sequence of the cloned parent 7α-steroid dehydrogenase is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2; it is determined that the cloned parent l...

Embodiment 2

[0032] Preparation of co-expression recombinant plasmids containing 7α-steroid dehydrogenase mutants

[0033] Perform site-directed mutation on the 7α-steroid dehydrogenase parent by reverse PCR technology, design reverse primers at the mutation position, use upstream and downstream mutation primers to amplify the target fragment, and introduce corresponding mutations on the primers to recombine plasmid pET22b-AHSDH2 -LDH was used as a template for inverse PCR, and the PCR product was transformed into Escherichia coli Rosetta (de3) after being digested with Dpn I enzyme, and colonies were picked and sent for sequencing after being screened by Amp. The mutation sites and primer design are shown in Table 1.

[0034] The PCR system is: TaKaRa EX Taq HS 0.25ul; 10×Ex Taq Buffer 5ul; template plasmid 1ul; dNTP (2.5mM each) 4ul; upstream primer 1ul; downstream primer 1ul; sterile water up to 50ul.

[0035] The PCR program is: first 98°C for 2min; then 98°C for 10s, 55-56°C for 30s,...

Embodiment 3

[0039] Preparation of enzyme solution

[0040] The parent and mutant co-expression recombinant plasmids prepared in Example 1 and Example 2 were respectively transferred into Escherichia coli Rosetta (de3), and then the recombinant Escherichia coli was inoculated in a small volume of LB medium (containing 100 μg / mL of Amp ), after culturing overnight at 30-37°C, transfer it to a certain volume of LB medium (containing 100 μg / mL Amp) with an inoculum size of 1-5%, and continue culturing OD at 30-37°C 600 After reaching 0.6-1.0, add isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.1 mM-1 mM, induce expression at 20-37° C. for 10-20 hours, and then collect the bacteria by centrifugation. Suspend the fermented cells in a certain volume of 50-100mM potassium phosphate buffer (pH8.0), break the cells by ultrasonic, and centrifuge to obtain the parent protein containing lactate dehydrogenase and 7α-steroid dehydrogenase or dehydrogenated with 7α-steroid The crude e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing 3α-hydroxy-7-oxo-5β-cholanic acid by using biological enzyme catalysis technology and 7α-steroid dehydrogenase for preparation thereof. The method uses chenodeoxycholic acid as a substrate, and in the presence of NAD, lactate dehydrogenase, sodium pyruvate and buffer solution, uses 7α-steroid dehydrogenase to catalyze chenodeoxycholic acid to prepare 3α-hydroxy-7 Oxo-5β-cholanic acid with 7α-steroid dehydrogenase from Halomonas Halomonas jeotgali sp. The method has the advantages of simple operation, mild and easy-to-control reaction conditions, short reaction time, a substrate conversion rate as high as over 99.7%, and the obtained product content is over 97.5%.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a method for preparing 3α-hydroxyl-7oxo-5β-cholanic acid by using biological enzyme catalysis technology and 7α-steroid dehydrogenase for preparation thereof. Background technique [0002] 3α-Hydroxy-7-oxo-5β-cholanic acid, also known as 7-ketolithocholic acid, is an important intermediate for the preparation of ursodeoxycholic acid. Ursodeoxycholic acid is the main active ingredient of bear bile, a precious traditional Chinese medicine. It has the functions of increasing bile acid secretion, changing bile components, reducing cholesterol and cholesterol lipids in bile, and is mainly used for the treatment of gallstone diseases. As we all know, bear bile is a very scarce resource, because the traditional way of obtaining it mainly relies on the method of artificially breeding live bears to extract bile. At present, this long-term, low-yield and inhumane tradit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P33/02C12N9/04
CPCC12N9/0006C12P33/02C12Y101/01159C12P33/00
Inventor傅荣昭刘立辉刘滔滔曹磊彭亭
OwnerZHONGSHAN BONTAC BIO TECH CO LTD