Preparation method and application of flagellin FliC from salmonella abortus equi
A Salmonella and flagellin technology, applied in the fields of bioengineering and immunity, can solve the problems of FliC protein research and utilization of rare reports, etc., and achieve the effect of good immune protection effect, high immune protection rate and good immunogenicity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: PCR amplification of FliC gene
[0043] Using the extracted genomic DNA of Salmonella equine abortus as a template, the total reaction volume was 25 μL, and the PCR conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 32 cycles, 72 ℃ for a final extension of 10 min. After the reaction, the amplified products were electrophoresed on a 1% agarose gel.
Embodiment 2
[0044] Example 2: Construction of recombinant prokaryotic expression plasmid pGEX-4T-FliC
[0045] Design primers based on the cloned and sequenced FliC gene sequence: Upstream primer: 5'-GTA GGATCC ACCAACTCCCGGTCTGACCTCGACTCCATCC -3'; downstream primer: 5'-TAA CTCGAG TATTGTAGGTTTTTACCGTCGATAGAAACAAC -3', the amplified fragment size is 840bp. The template was the genome of Salmonella equine abortus strain MS97, and the PCR conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 32 cycles, and final extension at 72°C for 10 min. The FliC gene fragment obtained by PCR amplification was used respectively Bam HI, X ho After Ⅰ digestion, it was connected into the pGEX-4T-2 vector and transformed into E. coli BL21(DE3) competent cells. The positive clones were extracted and identified by enzyme digestion, and the constructed FliC prokaryotic expression vector was identified by en...
Embodiment 3
[0046] Example 3: Expression and purification of FliC protein
[0047] Pick the correct sequenced monoclonal colonies and culture them overnight in LB (Amp+, 100 μg / mL) medium, transfer to fresh LB (Amp+, 100 μg / mL) medium the next day at 1.5%, and culture at 37 °C to OD600 Equal to about 0.5, add IPTG to a final concentration of 0.1 mmol / L, induce for 4.5 hours at 29 °C, collect the bacteria by centrifugation, break the bacteria by ultrasonication, centrifuge at low temperature to get the supernatant, and analyze the expression of the target protein in the supernatant by SDS-PAGE. The sonicated supernatant containing the GST-tagged protein was purified through a purification chromatography column, and 3 mL of elution buffer was added to the column to elute the protein to elute the target protein.
[0048] SDS-PAGE electrophoresis was performed on the induced bacterial samples and the purified protein samples. The results of electrophoresis showed that compared with the contr...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap