Method for evolving host specificity of bacteriophage

A host-specific, bacteriophage technology, applied in the biological field, can solve the problems of lack of understanding of bacteriophage, the challenges of transformation and mass production of unknown bacteriophages, and the impossibility of host-specificity, so as to promote the process of host-specificity and simplify host-specificity. The effect of the sexual process

Inactive Publication Date: 2018-07-10
SHENZHEN INST OF ADVANCED TECH
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The diversity of phages in nature is extremely high, but people's understanding of them is lacking. The effect of using naturally isolated phages to treat bacterial infections is somewhat unpredictable, and it is also a challenge to transform and mass-produce unknown phages.
Furthermore, host-specific evolution of phages directly based on wild-type hosts and phages is nearly impossible due to the presence of strong interspecies evolutionary barriers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for evolving host specificity of bacteriophage
  • Method for evolving host specificity of bacteriophage
  • Method for evolving host specificity of bacteriophage

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of embodiment 1 springboard host

[0047] The Kan resistance gene fragment was amplified by PCR using a pair of primers containing homology arms, and then the corresponding fragment of the waaC gene on the Escherichia coli W3110 genome was replaced by homologous recombination to obtain the correct waaC knockout strain. The primers containing the homology arms are

[0048] F: AGTTTAAAGGATGTTAGCATGTTTTACCTTTATAATGATGATAACTTTTC (SEQ ID NO. 1);

[0049] R: TACTGGAAGAACTCAACGCGCTATTGTTACAAGAGGAAGCCTGACGGATG (SEQ ID NO. 2).

[0050] The PCR reaction system is:

[0051]

[0052] The PCR reaction procedure is:

[0053] 95°C for 5 minutes;

[0054] 28 cycles of 95°C for 30sec, 54°C for 30sec, and 72°C for 1.5min;

[0055] 72°C for 10 minutes.

[0056] The method of homologous recombination is specifically as follows: first, Dpn I is used to treat the PCR product containing the homology arm and the Kan resistance gene fragment, and then the PCR product i...

Embodiment 2

[0062] The construction of embodiment 2 superphage

[0063] Set the plaque forming units (PFU) to 10 7 / ml of T7 phage was shaken and mixed with the springboard host at MOI=1. After standing still for 20 minutes, add LB medium containing 0.6% agar at a temperature of 50°C, shake and mix well, and pour it into the pre-prepared lower layer of LB for solid culture. base (agar content 1.5%), let stand at room temperature for 1 hour until the upper layer of agar is solidified, put it into a 37°C constant temperature incubator, and after overnight cultivation, usually 1-2 phage plaques are produced on a plate, which is "super phage 1.0" .

Embodiment 3

[0064] Example 3 Sequencing of Superphage 1.0

[0065] The products of genes11, 12, and 17 of T7 phage are the main receptor-binding proteins responsible for recognizing and binding LPS, wherein gene11 encodes tail tube protein A, gene12 codes tail tube protein B, and gene17 codes tail fiber protein. Pick the superphage 1.0 obtained in Example 2, use the springboard host to further amplify the culture, then extract the phage DNA, use PCR to amplify T7 phage and gene11, gene12, gene17 fragments of the superphage, perform Sanger sequencing after purification, and then compare Analysis of mutation sites of super phages, the results are as follows image 3 shown.

[0066] Figure 4 The results showed that gene12 carried a base mutation (A was replaced by G), and gene17 carried a base mutation (G was replaced by T), both of which were sense mutations.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnologies, and provides a method for evolving the host specificity of a bacteriophage by the aid of a springboard host, the obtained springboard host and the obtained bacteriophage. The method, the springboard host and the bacteriophage have the advantages that lipopolysaccharide structures in bacteriophage hosts start to be transformed from known bacteriophages with clear genetic backgrounds by the aid of ideas and means of evolutionary biology and synthetic biology to obtain the springboard host, the springboard host can be infected by bacteriophages to obtain bacteriophages with variant receptor binding proteins, and the host specificity of the bacteriophages is changed, so that new host bacteria can be recognized and infected by the bacteriophages; as shown by experiments, the obtained bacteriophage can resist Gram-negative bacteria and multidrug-resistant bacteria, plaque can be generated, growth can be inhibited, and the bacteriophage has the potential of supplement and reinforcement effects for bacteria infection treatment by the aid of antibiotics.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for evolving phage host specificity by using a springboard host. Background technique [0002] Phages, a class of viruses that infect bacteria, are the most ubiquitous and diverse species in the ecosystem. Phages are widely distributed in areas where bacteria are concentrated, such as soil or animal guts. Seawater is also one of the most dense natural sources of phages, with up to 70% of marine bacteria infectable by phages. The characteristic of phage is that it does not have a cell structure, and is mainly composed of a single nucleic acid DNA or RNA genome wrapped in a protein shell, which can encode as few as several or as many as several hundred genes. Phage must use resources such as energy and protein in the host cell to achieve its own growth and proliferation, and cannot grow or replicate independently. Phage recognizes the host by specifically bindin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/00C12N1/21A61K35/76A61P31/04C12R1/92C12R1/19
CPCA61K35/76C12N7/00C12N9/1048
Inventor刘陈立肖敏凤孙陈健
OwnerSHENZHEN INST OF ADVANCED TECH