Supercharge Your Innovation With Domain-Expert AI Agents!

A wheat powdery mildew resistance-related protein tawrky49 and its coding gene and application

A technology related to wheat powdery mildew and resistance, which can be used in application, genetic engineering, plant genetic improvement, etc., and can solve problems such as scarcity

Active Publication Date: 2021-06-25
QINGDAO UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, wheat powdery mildew resistance gene resources are relatively scarce, and it is urgent to discover wheat disease resistance gene resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A wheat powdery mildew resistance-related protein tawrky49 and its coding gene and application
  • A wheat powdery mildew resistance-related protein tawrky49 and its coding gene and application
  • A wheat powdery mildew resistance-related protein tawrky49 and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, TaWRKY49 Gene acquisition

[0041] 1. Obtaining RNA

[0042] The 7-day seedlings of wheat variety Shannong 20 were inoculated with Erysiphysis tritici physiological race E09, and the samples were collected for 48 hours to extract RNA.

[0043] 2. Obtain cDNA by reverse transcription

[0044] Reverse transcription system:

[0045] RNA 2.5 μL, Oligo-dT primer 1 μL, DEPC water 6.5 μL, mix the above solutions in a centrifuge tube, incubate at 65°C for 5 minutes, and place on ice for another 5 minutes.

[0046] Then add 5 μL of 5× reverse transcription buffer solution, 1.25 μL of dNTP mix, 0.625 μL of inhibitor, 1 μL of M-MLV reverse transcriptase, 7.125 μL of DEPC water to the above system, incubate at 42°C for 1 hour, and incubate at 95°C for 5 minutes. cDNA was obtained.

[0047] 3. Clone TaWRKY49

[0048] Add the above cDNA to 25 μL double distilled water, take 1 μL for subsequent PCR reaction as a template, and use the following primers for PCR am...

Embodiment 2

[0054] Embodiment 2, TaWRKY49 Application of Genes in Resistance to Powdery Mildew

[0055] 1. Identification of the regulatory role of TaWRKY49 on wheat powdery mildew resistance by gene gun transient overexpression technology

[0056] 1. Carrier Construction

[0057] 1) Using the PCR product obtained in Example 1 (or the artificially synthesized sequence 1) as a template, perform PCR amplification with the following primers to obtain a PCR product of about 1.2Kb.

[0058] Forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCATCTTGTGGCGGC (SEQ ID No. 5)

[0059] Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATAAAAAAATATTACTAC (SEQ ID No. 6)

[0060] 2) Use the PCR product obtained in step 1) to perform BP reaction with the pDNOR201 vector (purchased from Invitrogen) to obtain the ENTRY vector.

[0061] The above BP reaction system: PCR product 75ng, pDNOR201 75ng, BPase 0.5 μL, overnight at 25°C.

[0062] 3) Perform LR reaction between the above ENTRY vector and pUbi-A...

Embodiment 3

[0113] Example 3. Analysis of subcellular localization of TaWRKY49 and expression pattern induced by powdery mildew

[0114] 1. Subcellular localization of TaWRKY49

[0115] 1. Carrier Construction

[0116] 1) Using the PCR product obtained in Example 1 (or the artificially synthesized sequence 1) as a template, perform PCR amplification with the following primers to obtain a PCR product of about 1.2Kb.

[0117] Forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCATCTTGTGGCGGCG (SEQ ID No. 9)

[0118] Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAAAAAAATATTACTACTAC (SEQ ID No. 10)

[0119] 2) Use the PCR product prepared in step 1) to perform BP reaction with the pDNOR201 vector (purchased from Invitrogen) to obtain the ENTRY-TaWRKY49 vector.

[0120] The above BP reaction system: PCR product 75ng, pDNOR201 75ng, BPase 0.5μL, overnight at 25°C.

[0121] 3) React the above ENTRY-TaWRKY49 vector with pUbi-Gateway-mYFP vector LR to generate pUbi-TaWRKY49-mYFP vector.

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a wheat powdery mildew resistance-related protein TaWRKY49 and its coding gene and application. The protein is the following (a) or (b) protein: (a) protein composed of amino acid sequence shown in SEQ ID No.2; (b) amino acid sequence shown in SEQ ID No.2 after one or several amino acids A protein derived from (a) that has substitution, deletion or addition of residues and is associated with disease resistance or has transcription activation activity. The present invention discovers wheat protein TaWRKY49, transiently overexpresses its coding gene, and finds that it can resist wheat powdery mildew caused by E. The protein provided by the invention can lay a foundation for the research of breeding transgenic wheat with resistance to wheat powdery mildew.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a wheat powdery mildew resistance-related protein TaWRKY49 and its coding gene and application. Background technique [0002] Powdery mildew of wheat is caused by the obligate parasitic fungus Powdery mildew Bgt ( Blumeria graminis fsp .tritici ) caused by a fungal disease, is a worldwide distribution of the disease, seriously affecting the world's wheat production. In recent years, due to the increase of crop planting density, the increase of nitrogen fertilizer application, and the single planting of crops, the damage caused by wheat powdery mildew has become increasingly serious. The disease can infect the above-ground organs of wheat plants, but the leaves and leaf sheaths are the main ones. When the disease is severe, glumes and awns can also be affected. Generally, the yield can be reduced by 10% to 40%, and the yield of severely diseased fields can be reduced by more than...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8282
Inventor 常诚王晓宇岳同卿刘娇
Owner QINGDAO UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More