Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aptamer for vibrio vulnificus recognition and screening method and application thereof

A nucleic acid aptamer and Vibrio vulnificus technology, which is applied in the field of nucleic acid aptamers and ssDNA nucleic acid aptamers, can solve the problems of few reports and achieve the effects of low detection limit, high affinity and wide application value

Active Publication Date: 2018-12-28
JIANGSU OCEAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Many excellent properties of DNA nucleic acid aptamers indicate that it can be applied to the rapid detection of Vibrio vulnificus, but there are few reports on the rapid detection of Vibrio vulnificus as a target using nucleic acid aptamers at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer for vibrio vulnificus recognition and screening method and application thereof
  • Aptamer for vibrio vulnificus recognition and screening method and application thereof
  • Aptamer for vibrio vulnificus recognition and screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1, a kind for Vibrio vulnificus ( Vibrio vulnificus ) A specifically recognized ssDNA nucleic acid aptamer, the nucleotide sequence of the nucleic acid aptamer is the nucleotide sequence of the DNA fragment shown in Apt-Vv01: Apt-Vv01:

[0037] 5’- ctgcagaattctaatacgagtcactataggaagatggcgaaacatcttttctgatgagagttgcgacctcccg

[0038] gatgagtgccctggctccgggtttgtctatttttgggggtgttgacagatatccttagtgacggtaagcttggcac-3’.

[0039] The specific steps of the screening method for specifically recognized ssDNA nucleic acid aptamers are as follows:

[0040] (1) Synthesize (Shanghai Shenggong) initial DNA screening library containing 80 random bases and forward and backward primers.

[0041] Initial library: 5’- GGCGAAACATCTT- N80-TAGTGACGGTAAGCTTGGCAC-3’

[0042] Primer 1: 5’-GTGCCAAGCTTACCG-3’

[0043] Primer 2: 5’-CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACA-3’

[0044] (2) Use LB medium to culture Vibrio vulnificus, stop the culture when its OD600nm is close to 1, and detect the number of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is an ssDNA aptamer for specific recognition of vibrio vulnificus. The nucleotide sequence of the aptamer is a nucleotide sequence of a DNA fragment shown by Apt-Vv01. The invention alsoprovides a screening method for recognizing an aptamer of vibrio vulnificus. Property recognition and application are performed on the aptamer according to the affinity of the aptamer to the vibrio vulnificus. The aptamer consists of 149 bases and has a special secondary structure. The aptamer can be applied to rapid detection of vibrio vulnificus in medical diagnosis, environmental detection, food processing, aquaculture and the like. The aptamer effectively protects water bodies from being contaminated by the pathogen, and has wide application value especially in diagnosis, aquaculture andwater pollution prevention.

Description

Technical field [0001] The present invention relates to a nucleic acid aptamer, especially a kind for Vibrio vulnificus ( Vibrio vulnificus ) Specific recognition ssDNA nucleic acid aptamer. The invention also relates to a screening method and application of the aptamer, which belongs to the technical field of marine pathogenic microorganism detection. Background technique [0002] Vibrio vulnificus ( Vibrio vulnificus ) Is a gram-negative halophilic bacterium that lives in estuaries and marine coastal areas, and is one of the important pathogenic bacteria of marine organisms. In 1976, the Centers for Disease Control and Prevention of the United States isolated Vibrio vulnificus from blood samples for the first time. It can cause human digestive system diseases and can cause death in severe cases. It is also a serious pathogenic bacteria in aquaculture. In aquaculture, the deterioration of the breeding environment or the injury of aquatic animals can cause the infection of Vibri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115G01N33/569
CPCG01N33/56911C12N15/115
Inventor 王淑军吕明生闫婉丽谷利德房耀维陈丽任伟
Owner JIANGSU OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com