Isothermal amplification nucleic acid detection method based on helicase and nicking enzyme and kit

A detection kit, isothermal amplification technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as laboratory contamination, and achieve the effect of convenient operation, reduced possibility, and real-time detection of fluorescent signals

Inactive Publication Date: 2018-12-28
深圳百纳心致生命科学有限公司 +1
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology describes a way to detect DNA sequences quickly without being subjected to any purifying steps or reagents like other chemical agents. By combining certain probes together with specialized molecules called nucleotides (DNA), this technique allows for precise analysis even when there may have multiple copies of each genetic material introduced into different samples simultaneously.

Problems solved by technology

Technological Problem: Current Methods Using Loop MediatedIsorption/Amplexization (LMAC)/isothermality (ISAA)) have limitations when applied to nucleic analysis because they involve complicated procedures involving various steps like pretreatment, purifying, and isolating samples from each others. Additionally, Labeled oxygen labeling (LOX)-based assays suffer issues caused by nonlinear responses between labeled bases and targets. There remains room for improvement through improved technologies including thermocyclability amplification systems, chemical modification processes, and closed loop transfer catalysts.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isothermal amplification nucleic acid detection method based on helicase and nicking enzyme and kit
  • Isothermal amplification nucleic acid detection method based on helicase and nicking enzyme and kit
  • Isothermal amplification nucleic acid detection method based on helicase and nicking enzyme and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 human genome GAPDH gene detection

[0039] 1. Detection kit preparation

[0040] (1) Specific primer design

[0041] For the GAPDH gene of the human genome, multiple parameters such as melting temperature, GC content, primer length, primer structure, and primer-dimer were comprehensively considered to design specific primer pairs, as shown below.

[0042] Amplified fragment (SEQ ID NO:1):

[0043] CGGGTGATGCTTTTCCTAGATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCCTCTTGTGTCCCCTCCCCGCAGAGGTGTGGTGGCTGTGGCATGGTGCCAAGCCGGGAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTCCACCGCAAAATGGCCCCTCTG

[0044] Upstream primer Primer F (SEQ ID NO:2): 5'-CGGGTGATGCTTTTCCTAGATT-3'

[0045] Downstream primer Primer R (SEQ ID NO:3): 5'-CAGAGGGGCCATTTTGCGG-3'

[0046] (2) Specific Taqman probe design

[0047] Design specific Taqman probes based on single-stranded target nucleic acid templates, and the probe sequences contain nicking enzyme recognition sites. A fluorescent group is attached...

Embodiment 2

[0057] Example 2 Clostridium difficile toxin-producing gene TcdB detection

[0058] 1. Detection kit preparation

[0059] (1) Design of specific primers and probes

[0060] Design specific primers and probes for the detection target sequence Clostridium difficile toxin-producing gene TcdB, as shown below.

[0061] Amplified fragment (SEQ ID NO:5):

[0062] CACAAGTGGTAGAAGAAAGGATTGAAGAAGCTAAAAGCTTAACTTCTGACTCTATTAATTATATAAAGAATGAATTTAAACTAATAGAATCTATTTCTGATGCACTATACGATTTAAAACAACAGAATGAATTAGAAGAGTCTCATTTATATCTTTTGAGGATATATCGGAGACTGATGAAGGCT

[0063] Upstream primer Primer F (SEQ ID NO:6): 5'-CACAAGTGGTAGAAGAAAGGATTG-3'

[0064] Downstream primer Primer R (SEQ ID NO:7): 5'-AGCCTTCATCAGTCTCCGATA-3'

[0065] Probe sequence probe (SEQ ID NO:8): 5'-FAM-AAGAGTCTCATTTTATATCTTTT-BHQ-3'

[0066] (2) Reaction system preparation

[0067] Each 20 μL amplification reaction system contains 4 μL 5× buffer, 2 μL 10 mM dNTP, 1 μL 8U / μL BST polymerase, 0.5 μL 200ng / μL UvrD helicase, 0.5 μL ...

Embodiment 3

[0074] Embodiment 3 pathogenic bacteria detection specificity analysis

[0075] Using the kit and detection method described in Example 2, select Escherichia coli, Salmonella, Staphylococcus aureus, Shigella baumannii, Shigella dysenteriae, Clostridium bienzyme, Clostridium perfringens and Non-toxin-producing Clostridium difficile was used as the test sample to detect the toxin-producing gene TcdB of Clostridium difficile, and the specificity of the kit and detection method described in Example 2 in the detection of pathogenic bacteria was analyzed. The specific experimental settings are shown in Table 1.

[0076] Table 1 Pathogen detection specificity analysis experiment settings

[0077] test group

pathogenic bacteria

concentration

1

Toxigenic Clostridium difficile

5000CFU / mL

2

Toxigenic Clostridium difficile

500CFU / mL

3

Escherichia coli, Salmonella

10 6 CFU / mL

4

Staphylococcus aureus, Shigella baumannii ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an isothermal amplification nucleic acid detection method based on helicase and nicking enzyme. The isothermal amplification nucleic acid detection method comprises the following steps that S1, a specific amplification primer and a Taqman probe with nicking enzyme recognition sites are designed according to a target nucleotide sequence; S2, a sample nucleic acid is subjected to enzyme treatment to obtain a single-chain nucleic acid template; S3, the Taqman probe obtained in the step S1 and the single-chain nucleic acid template obtained in the step S2 are specifically bonded to obtain a specific bonding product, the specific bonding product is digested by using the nicking enzyme, and real-time detection of fluorescence signals is achieved. The helicase and nickingenzyme are used jointly, the Taqman probe with nicking enzyme recognition sites is designed, a large number of nucleic acid products do not need to be amplified, only an appropriate amount of single-chain templates is needed, and then detection can be performed by using the nicking enzyme to constantly cut the probe bound with recognition sites, the shortcoming of lab pollution likely caused by isothermal amplification can be avoided, and the isothermal amplification nucleic acid detection method is simple and quick to operate and suitable for on-site quick detection.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner深圳百纳心致生命科学有限公司