A kind of cotton fusarium wilt resistance gene and its application

A cotton fusarium wilt and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of loss of cotton resistance to fusarium wilt, and achieve high cost, high efficiency, and high accuracy

Inactive Publication Date: 2020-11-20
HUAZHONG AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Inhibiting the expression of this gene completely lost the resistance of cotton to Fusarium wilt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cotton fusarium wilt resistance gene and its application
  • A kind of cotton fusarium wilt resistance gene and its application
  • A kind of cotton fusarium wilt resistance gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Genome-wide Association Analysis of Cotton Fusarium Wilt Resistance Genes

[0036] Taking 293 upland cotton cultivars whose genomes have been sequenced by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University where the applicant works as the association analysis group, the SNP variation with the minimum allele frequency less than 0.05 was filtered, and the filtered SNP It is used to calculate the population structure, principal component analysis and phylogenetic analysis. The structure software is used to analyze the population structure of the population. The K value is calculated from 1 to 10, and five repetitions are performed. The Evanno'sΔK value is obtained when K=2 Maximum ( figure 1 A. figure 1 B), using Tassel5 for principal component analysis ( figure 1C), using Phylip for phylogenetic analysis, and then drawing with Figtree ( figure 1 D), according to the above analysis, it can be identified that the group is ...

Embodiment 2

[0040] Example 2: VIGS verifies the impact of candidate genes on cotton fusarium wilt resistance

[0041] 1. VIGS vector construction and silencing effect detection

[0042] Primers were designed according to the coding sequences of 24 candidate genes for the construction of VIGS vectors, a KpnI restriction site (GCGTGAGCTCGGTACC) was added to the 5' end of the forward primer, and a BamHI restriction site (GCCTCCATGGGGATCC) was added to the 5' end of the reverse primer , and the nucleotide sequences of the specific primers are shown in Table 2. The construction of VIGS vector refers to the report of Gao Wei (Gao et al2013). After the vector was constructed, it was transformed into Agrobacterium strain GV3101 by electric shock.

[0043] Table 2 Primer pairs designed for 23 candidate genes

[0044] gene name forward primer reverse primer Gh_D03G0203 CCGTTCTGGATTTTATTGCTGG TGGAAAAGTTGTTGTGCTTGAAATA Gh_D03G0204 ATGGCGGAAACTCTAGCAAAG TTCAACAACAGAC...

Embodiment 4

[0051] Example 4: Agrobacterium-mediated tobacco transient expression and trypan blue staining

[0052] Primers were designed according to the DNA sequence of GhFov1. AttB site sequences and protective bases for recombination were added to both ends of the primers. The primers were named forward primer: OE-GhFov1-F (GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGTCTGCTAAGATTTTTGCT) and reverse primer: OE- GhFov1-R (GGGGACCACTTTGTACAAGAAAGCTGGGTGGGAGCTGGTAAGTTGTGTTT). Then use the DNA of the Fusarium wilt-resistant variety 'Yinshan 4' and the Fusarium wilt-susceptible variety 'Xinluzao 8' as templates for PCR amplification, and connect GhFov1 to the 4X MYC vector pGWB417 by BP and LR reactions to obtain Transient expression vectors p35s-GhFov1-R and p35s-GhFov1-S. Transform the constructed transient expression vector into the Agrobacterium GV3101 strain by conventional electric shock method, then inject the Agrobacterium liquid into tobacco for transient expression, and then inject Fusariu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering and particularly relates to a cotton blight-resistant gene and application thereof. By cotton population blight-resistant authentication and full-genome association analysis, an upland cotton blight-resistant gene is located in a 400kb genome section of No.17 chromosome 1.7-2.1MB. By a virus induced gene silencing technology, expression of all genes in the genome section is inhibited, and inoculation of a cotton blight-resistant major gene GhFov1 obtained by screening after authentication is carried out. The gene encodesa glutamate receptor protein kinase, and blight resistance is evidently lowered after silencing in anti-disease upland cotton. According to tobacco transformation, GhFov1 protein is capable of recognizing cotton blight germs and activating immunoreactions to result in anaphylactic necrosis. By development of a pair of primers capable of detecting GhFov1 genotype in upland cotton, blight resistance of cotton genetic resources and varieties can be assessed through the primers and an optimized PCR reaction system.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the identification of a cotton fusarium wilt resistance gene and the development and application of a cotton fusarium wilt resistance molecular marker. Background technique [0002] Fusarium wilt is a worldwide soil-borne disease in cotton production. When the disease is severe, it can lead to the death of cotton plants in the seedling and bud-boll stages, resulting in the loss of cotton production. less, poor boll opening, resulting in decreased fiber quality and yield (Wan Ying; 2005). Fusarium wilt has brought immeasurable losses to cotton production, seriously affecting the stability and sustainable development of cotton production. In Xinjiang, the largest cotton producing area in my country, cotton blight still occurs from time to time. The most effective way to control cotton fusarium wilt is to breed and spread disease-resistant varieties. Since the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12Q1/6895C12N15/11
CPCC07K14/415C12Q1/6895C12Q2600/13
Inventor朱龙付张献龙柳仕明
OwnerHUAZHONG AGRI UNIV