A kind of cotton fusarium wilt resistance gene and its application
A cotton fusarium wilt and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of loss of cotton resistance to fusarium wilt, and achieve high cost, high efficiency, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Genome-wide Association Analysis of Cotton Fusarium Wilt Resistance Genes
[0036] Taking 293 upland cotton cultivars whose genomes have been sequenced by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University where the applicant works as the association analysis group, the SNP variation with the minimum allele frequency less than 0.05 was filtered, and the filtered SNP It is used to calculate the population structure, principal component analysis and phylogenetic analysis. The structure software is used to analyze the population structure of the population. The K value is calculated from 1 to 10, and five repetitions are performed. The Evanno'sΔK value is obtained when K=2 Maximum ( figure 1 A. figure 1 B), using Tassel5 for principal component analysis ( figure 1C), using Phylip for phylogenetic analysis, and then drawing with Figtree ( figure 1 D), according to the above analysis, it can be identified that the group is ...
Embodiment 2
[0040] Example 2: VIGS verifies the impact of candidate genes on cotton fusarium wilt resistance
[0041] 1. VIGS vector construction and silencing effect detection
[0042] Primers were designed according to the coding sequences of 24 candidate genes for the construction of VIGS vectors, a KpnI restriction site (GCGTGAGCTCGGTACC) was added to the 5' end of the forward primer, and a BamHI restriction site (GCCTCCATGGGGATCC) was added to the 5' end of the reverse primer , and the nucleotide sequences of the specific primers are shown in Table 2. The construction of VIGS vector refers to the report of Gao Wei (Gao et al2013). After the vector was constructed, it was transformed into Agrobacterium strain GV3101 by electric shock.
[0043] Table 2 Primer pairs designed for 23 candidate genes
[0044] gene name forward primer reverse primer Gh_D03G0203 CCGTTCTGGATTTTATTGCTGG TGGAAAAGTTGTTGTGCTTGAAATA Gh_D03G0204 ATGGCGGAAACTCTAGCAAAG TTCAACAACAGAC...
Embodiment 4
[0051] Example 4: Agrobacterium-mediated tobacco transient expression and trypan blue staining
[0052] Primers were designed according to the DNA sequence of GhFov1. AttB site sequences and protective bases for recombination were added to both ends of the primers. The primers were named forward primer: OE-GhFov1-F (GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGTCTGCTAAGATTTTTGCT) and reverse primer: OE- GhFov1-R (GGGGACCACTTTGTACAAGAAAGCTGGGTGGGAGCTGGTAAGTTGTGTTT). Then use the DNA of the Fusarium wilt-resistant variety 'Yinshan 4' and the Fusarium wilt-susceptible variety 'Xinluzao 8' as templates for PCR amplification, and connect GhFov1 to the 4X MYC vector pGWB417 by BP and LR reactions to obtain Transient expression vectors p35s-GhFov1-R and p35s-GhFov1-S. Transform the constructed transient expression vector into the Agrobacterium GV3101 strain by conventional electric shock method, then inject the Agrobacterium liquid into tobacco for transient expression, and then inject Fusariu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


