Check patentability & draft patents in minutes with Patsnap Eureka AI!

Building and application of lineage tracing system in human pluripotent stem cells

A tracing and pedigree technology, which is applied in the construction and application of pedigree tracing systems, and can solve problems such as difficulties in constructing pedigree tracing systems

Pending Publication Date: 2019-02-12
TONGJI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complexity of operating human cells, especially human embryonic stem cells, it is very difficult to construct a lineage tracing system in human cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building and application of lineage tracing system in human pluripotent stem cells
  • Building and application of lineage tracing system in human pluripotent stem cells
  • Building and application of lineage tracing system in human pluripotent stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] Functional validation of controllable reporter elements in hPSCs:

[0102] Integration of the LSL-GFP element into the AAVS1 locus of the human genome. The AAVS1-CAGGS-eGFP plasmid contains the homology arms required for integration into the AAVS1 site, SA (splice acceptor sequence), the resistance gene Puro for screening, and the reporter gene GFP (Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol. 2011 Jul 7; 29(8):731-4. doi: 10.1038 / nbt.1927.). The LSL fragment is obtained by PCR, and the LSL fragment is specifically LoxP-STOP-LoxP, and a STOP fragment is inserted into two LoxP fragments, and the specific sequences of the LoxP fragment and the STOP fragment are as follows:

[0103] LoxP: ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO. 1)

[0104]STOP:TCGCGATGAATAAATGAAAGCTTGCAGATCTGCGACTCTAGAGGATCTGCGACTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCT...

Embodiment 2

[0122] Functional validation of the lineage-specific switch element Cre in hPSCs:

[0123] To allow PAX6 and FOXA2 to drive the expression of Cre, replace the stop codons of PAX6 and FOXA2 with 2A-Cre sequences. 2A-Cre is composed of P2A sequences and Cre sequences connected in sequence from the 5' end to the 3' end, as follows:

[0124] P2A:GCCACTAACTTCTCCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCA

[0125] (SEQ ID NO.9)

[0126] Cre sequence:

[0127]ATGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGC...

Embodiment 3

[0144] Construction of PAX6-2A-Cre / AAVS1-LSL-GFP cell line:

[0145] AAVS1-LSL-GFP and hAAVS1-1L-TALEN, hAAVS1-1R-TALEN plasmids were electroporated in PAX6-2A-Cre and FOXA2-2A-Cre cell lines. After puromycin screening and selection of surviving single clones, PCR at the genomic AAVS1 site was performed. The PCR primers used were AAVS1-F1 / AAVS1-R1 and AAVS1-F2 / AAVS1-R2. For specific primers, see Example 1.

[0146] A 1270bp WT fragment was obtained by PCR with AAVS1-F1 / R1 primers, and a 1492bp HR fragment was obtained by PCR with AAVS1-F2 / R2 primers. #1, #3, #4, #6, #8 are Homo, #2, #5, #7 are Hetero (see Figure 14 ). The clone that successfully integrated the LSL-GFP fragment was retained in the PAX6-2A-Cre cell line, and #4 clone was selected for SB identification with GFP Probe (same as Example 1). It can be seen that the PAX6-2A-Cre / In the AAVS1-LSL-GFP cell line, there was no off-target phenomenon of ectopic integration of the LSL-GFP fragment (see Figure 15 ), indic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to building and application of a lineage tracing system in human pluripotent stem cells. A lineage tracing method provided by theinvention comprises the steps that lineage tracing is conducted through the lineage tracing system, a building method of the lineage tracing system comprises: a recombinase gene segment is integratedby a recombinase driving gene of human pluripotent stem cells; a report gene system is integrated by chromosome opening lotus AAVS, the report gene system comprises a transcription termination regulating element segment and a report gene segment, and the transcription termination regulation element segment corresponds to the recombinase. The lineage tracing system is built in the human cells, thereport gene is utilized to mark all daughter cells of target gene protein after being expressed, and accordingly tracing is conducted on differentiation, multiplication and space positioning of the cells and the daughter cells.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the construction and application of a lineage tracing system in human pluripotent stem cells. Background technique [0002] Lineage-Tracing (LT) is a technology that uses a specific method to mark a specific cell or a certain type of cell, so as to trace the differentiation, proliferation, spatial positioning, etc. of these cells and their progeny cells. With the rise of gene editing technology and the promotion and popularization of transgenic mouse technology, lineage tracing technology has become an important technical means to study mouse embryonic development, tumors, cell transplantation and other fields, and has received widespread attention. However, due to the complexity of operating human cells, especially human embryonic stem cells, it is very difficult to construct a lineage tracing system in human cells. Contents of the invention [0003] In view of the shortcomings o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/65
CPCC12N15/65C12N15/85C12N2800/30Y02A50/30
Inventor 章小清刘玲陈祯钰
Owner TONGJI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com