Building and application of lineage tracing system in human pluripotent stem cells
A tracing and pedigree technology, which is applied in the construction and application of pedigree tracing systems, and can solve problems such as difficulties in constructing pedigree tracing systems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0101] Functional validation of controllable reporter elements in hPSCs:
[0102] Integration of the LSL-GFP element into the AAVS1 locus of the human genome. The AAVS1-CAGGS-eGFP plasmid contains the homology arms required for integration into the AAVS1 site, SA (splice acceptor sequence), the resistance gene Puro for screening, and the reporter gene GFP (Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol. 2011 Jul 7; 29(8):731-4. doi: 10.1038 / nbt.1927.). The LSL fragment is obtained by PCR, and the LSL fragment is specifically LoxP-STOP-LoxP, and a STOP fragment is inserted into two LoxP fragments, and the specific sequences of the LoxP fragment and the STOP fragment are as follows:
[0103] LoxP: ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO. 1)
[0104]STOP:TCGCGATGAATAAATGAAAGCTTGCAGATCTGCGACTCTAGAGGATCTGCGACTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCT...
Embodiment 2
[0122] Functional validation of the lineage-specific switch element Cre in hPSCs:
[0123] To allow PAX6 and FOXA2 to drive the expression of Cre, replace the stop codons of PAX6 and FOXA2 with 2A-Cre sequences. 2A-Cre is composed of P2A sequences and Cre sequences connected in sequence from the 5' end to the 3' end, as follows:
[0124] P2A:GCCACTAACTTCTCCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCA
[0125] (SEQ ID NO.9)
[0126] Cre sequence:
[0127]ATGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGC...
Embodiment 3
[0144] Construction of PAX6-2A-Cre / AAVS1-LSL-GFP cell line:
[0145] AAVS1-LSL-GFP and hAAVS1-1L-TALEN, hAAVS1-1R-TALEN plasmids were electroporated in PAX6-2A-Cre and FOXA2-2A-Cre cell lines. After puromycin screening and selection of surviving single clones, PCR at the genomic AAVS1 site was performed. The PCR primers used were AAVS1-F1 / AAVS1-R1 and AAVS1-F2 / AAVS1-R2. For specific primers, see Example 1.
[0146] A 1270bp WT fragment was obtained by PCR with AAVS1-F1 / R1 primers, and a 1492bp HR fragment was obtained by PCR with AAVS1-F2 / R2 primers. #1, #3, #4, #6, #8 are Homo, #2, #5, #7 are Hetero (see Figure 14 ). The clone that successfully integrated the LSL-GFP fragment was retained in the PAX6-2A-Cre cell line, and #4 clone was selected for SB identification with GFP Probe (same as Example 1). It can be seen that the PAX6-2A-Cre / In the AAVS1-LSL-GFP cell line, there was no off-target phenomenon of ectopic integration of the LSL-GFP fragment (see Figure 15 ), indic...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


