Novel MCO (multicopper oxidase) with function of efficient degradation of histamine

A multi-copper oxidase and biogenic amine technology, applied in the field of molecular biology, can solve the problems of neutral optimum pH, few types of biogenic amines for degradation, and low efficiency of histamine, and achieve the effect of improving enzyme activity

Inactive Publication Date: 2019-03-15
GUANGDONG PRB BIO TECH CO LTD +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented inventor describes an improved type called PolyCopper Oxide (PCO) that helps break down organic compounds like substances found on food or medicine such as nicotinonics drugs used for treatments against schizophrensis. Pioneering researchers discovered this special protein made up of two different types of polypeptides - one being more acid-stable than others at neutrality levels but still able to catalyze reactions between molecules containing nitrogen atoms. These properties make it ideal for use in various industries including chemical industry production processes where harmful materials are released into waterways due to environmental pollution issues caused by these products.

Problems solved by technology

This patented technical problem addressed in this patent relates to controlling and minimizing unwanted production of biogeneics like tryptophan during manufacturing processes due to their strong odors caused by these chemicals. Current techniques involve modifying feedstock with specific chemicals but they may also result in other negative side health impacts on consumers who consume them.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel MCO (multicopper oxidase) with function of efficient degradation of histamine
  • Novel MCO (multicopper oxidase) with function of efficient degradation of histamine
  • Novel MCO (multicopper oxidase) with function of efficient degradation of histamine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] According to the gene sequence of multi-copper oxidase in Lactobacillus fermentum strain 47-7genome (GenBank accession number: NZ_CP017712.1) in NCBI, primers were designed, and the genome of Lactobacillus fermentum (Lactobacillus fermentum) preserved in our laboratory was used as a template to amplify Increased copper oxidase gene. The primers required for amplification are as follows:

[0038] Upstream: ATGAATGAACCAGTTTTTCGATTC

[0039] Downstream: CTACATGTGCATCCCCATCTT

[0040] PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min and 30 s, 34 cycles; extension at 72°C for 10 min, and incubation at 4°C.

[0041] After the amplification is completed, it is verified by 1% agarose gel electrophoresis, such as figure 1 As shown, the amplified gene fragment with a size of about 1500bp is consistent with the size of the target gene, indicating that L. fermentum contains a multi-co...

Embodiment 2

[0043] (1) Vector construction: the gene obtained in Example 1 and pET-28a were double-digested with restriction endonucleases EcoRI and HindIII, and reacted in a metal bath at 37°C for 45 minutes. After the digested gene fragments and plasmids were recovered and purified, they were mixed at a molar ratio of 4-10:1, ligated by Solution I ligase, and ligated overnight in a metal bath at 16°C.

[0044] (2) Construction of recombinant bacteria: 5 μL of the ligation product prepared in step (1) was added to Escherichia coli JM109 competent cells, mixed evenly, and left to stand in ice for 30 minutes. After 90 seconds in a water bath at 42°C, immediately take it out and place it in ice for 2-5 minutes. Add 700μL LB to culture based on 37℃, 200r min -1 Shake culture for 1h. 4000r·min -1 Centrifuge for 2 minutes, discard most of the supernatant, and leave about 100 μL of the supernatant to resuspend the bacteria. The bacterial solution was evenly spread on a plate containing kana...

Embodiment 3

[0050] (1) Effect of temperature on enzyme activity and stability

[0051] The purified multi-copper oxidase was reacted with the substrate under different temperature conditions (25, 35, 40, 45, 50, 55, 60, 70, 80°C) to measure the enzyme activity, and the highest enzyme activity was taken as 100 %, calculate the relative enzyme activity at each temperature to determine the optimal reaction temperature of the enzyme.

[0052] The purified enzyme solution was warmed under various temperature conditions, and an appropriate amount of enzyme solution was taken every 3 hours to react with the substrate at the optimum reaction temperature, and the influence of different temperature conditions on the stability of the enzyme activity was determined.

[0053] Such as figure 2 As shown, when the temperature of MCOF is 30-60°C, the enzyme activity can reach more than 50%, and when the temperature is 50°C, the relative enzyme activity can reach 100%; image 3 As shown, when MCOF is lo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel MCO (multicopper oxidase) with the function of efficient degradation of histamine, and belongs to the technical field of molecular biology. The sequence of the MCO is shown as SEQ ID NO.1. The enzyme has higher histamine degradation performance, is wide in degradation spectrum, can degrade tryptamine, phenylethylamine, putrescine, cadaverine, histamine, tyramine andspermidine, particularly has good degradation effect on histamine, has histamine degradation rate of 82% within 24 h and has important industrial application potential.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
OwnerGUANGDONG PRB BIO TECH CO LTD