A kind of preparation method of the fish probe of top2a gene

A probe and gene technology, applied in the field of preparation of FISH probes, can solve the problems of increased false positive and false negative signals, limitations of design principles, and reduced detection sensitivity

Active Publication Date: 2020-01-24
SUREXAM BIO TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The above-mentioned technical idea is the conventional method of FISH detection method. After an in-depth analysis of its specific operation details, it can be found that: (1) the probe is involved in the target DNA region of the sample to be tested. Usually, one probe DNA molecule binds to one target For DNA molecules, once a single probe off-target occurs, it will have a significant impact on the detection signal; (2) The impact of a single probe off-target on the detection signal will then indirectly affect the accuracy of the detection, and the possibility of false positive and false negative signals will increase; (3) In addition to the impact on the detection signal and accuracy, the off-target of a single probe will also significantly reduce the sensitivity of detection; (4) In addition, the length of the probe molecule involved in TOP2A is about 300bp, as known in the art, The larger the probe molecule, the less likely it is to enter the interior of the cell
[0009] It can be seen that although the existing TOP2A gene detection technology has achieved relatively good results in some aspects, there are still many technical problems due to limitations in its design principles and other aspects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of preparation method of the fish probe of top2a gene
  • A kind of preparation method of the fish probe of top2a gene
  • A kind of preparation method of the fish probe of top2a gene

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0115] A method for preparing a FISH probe library of TOP2A gene, comprising the following steps:

[0116] (1) Prepare probe 1A and probe 1B;

[0117] (2) After digesting and breaking probe 1A and probe 1B obtained in step (1), respectively, use Taq DNA polymerase to complete the end and add the dA tail at the 3' end to obtain probe 2A and 2B respectively;

[0118] The enzyme cutting system is:

[0119] Reagent Amount added 10×CutSmart Buffer 5μL restriction endonuclease mix 2μL Probe 1A or 1B (1ng / μL) 40μL Taq DNA polymerase (5U / μL) 0.5μL 10mM dNTPs 1μL wxya 2 o

1.5μL

[0120] The reaction conditions for enzyme digestion and interruption are: 37°C for 30 minutes, 72°C for 20 minutes, and 80°C for 20 minutes;

[0121] (3) Add adapters to the probes 2A and 2B obtained in step (2) to obtain probes 3A and 3B respectively;

[0122] The system of the ligation reaction is:

[0123] Reagent Amount added ...

Embodiment 7

[0128] The condition of the connection reaction of embodiment 7 is:

[0129] temperature time 16℃ 60min 65℃ 10min 4℃ ∞

[0130] The ligation product was purified using the purification kit HiPure Nucleotide Remove Kit, the product was eluted with 25 μl of sterile ultrapure water, and 20 μl was taken for subsequent steps.

[0131] (4) performing asymmetric amplification on the probes 3A and 3B obtained in step (3) respectively to obtain a FISH probe library;

[0132] Asymmetric amplification reaction system:

[0133] Reagent Amount added 5X EpiMark Hot Start Taq Reaction Buffer 10μL dNTP Mixture (containing aminoallyl-dUTP) 3μL Epimark Hot stratTaq DNApolymerase 0.25 μL Nuclease-free water 14.75 μL Primer F (1μM) 1μL Primer R (20μM) 1μL Probe 3A or 3B 20 μL

[0134] Primer F and Primer R are:

[0135] name Base sequence (5'→3') Primer F CCTCTGTATGCGCATCCTGTGAT ...

Embodiment 1-9

[0147] Embodiment 1-9 is that on the basis of the basic embodiment, various parameters are adjusted to obtain the following embodiments:

[0148]

[0149]

[0150]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The present invention belongs to the field of biochemistry and particularly belongs to the field of biochemical related measurement or detection, and more specifically relates to a preparation methodof a FISH probe of a TOP2A gene, and the probe prepared by the method. The provided method prepares a probe library by using BAC cloning, enzyme digestion, asymmetric amplification, etc., so that theproduct is effectively improved in sensitivity, specificity and signal intensity.

Description

technical field [0001] The invention belongs to the field of biochemistry, in particular to the field of determination or detection related to biochemistry; more specifically, it relates to a method for preparing a FISH probe of TOP2A gene, and the probe prepared by the method. Background technique [0002] DNA topoisomerase (TOP) is an important ribozyme in cells, which mainly changes the topological structure of DNA through catalysis. Eukaryotic topoisomerases are mainly divided into TOP1 and TOP2. Among them, the intermediate product formed in the catalysis process that causes short breaks in the DNA double strand is called TOP2. TOP2 plays an important role in important life processes such as cell DNA replication, transcription and mitosis. Based on the understanding of the key role of TOP in cells, the research on this kind of substances has always been one of the hot spots in the development of anti-tumor drugs. Topoisomerase II inhibitors currently on the market in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6886C12Q1/6841C12Q1/6806C12N15/10C40B50/06
CPCC12N15/1093C12Q1/6806C12Q1/6841C12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/156C40B50/06C12Q2563/107C12Q2525/191C12Q2531/107C12Q2521/301
Inventor许嘉森吴诗扬刘志明朱蓉
OwnerSUREXAM BIO TECH