A kind of preparation method of the fish probe of top2a gene
A probe and gene technology, applied in the field of preparation of FISH probes, can solve the problems of increased false positive and false negative signals, limitations of design principles, and reduced detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0115] A method for preparing a FISH probe library of TOP2A gene, comprising the following steps:
[0116] (1) Prepare probe 1A and probe 1B;
[0117] (2) After digesting and breaking probe 1A and probe 1B obtained in step (1), respectively, use Taq DNA polymerase to complete the end and add the dA tail at the 3' end to obtain probe 2A and 2B respectively;
[0118] The enzyme cutting system is:
[0119] Reagent Amount added 10×CutSmart Buffer 5μL restriction endonuclease mix 2μL Probe 1A or 1B (1ng / μL) 40μL Taq DNA polymerase (5U / μL) 0.5μL 10mM dNTPs 1μL wxya 2 o
1.5μL
[0120] The reaction conditions for enzyme digestion and interruption are: 37°C for 30 minutes, 72°C for 20 minutes, and 80°C for 20 minutes;
[0121] (3) Add adapters to the probes 2A and 2B obtained in step (2) to obtain probes 3A and 3B respectively;
[0122] The system of the ligation reaction is:
[0123] Reagent Amount added ...
Embodiment 7
[0128] The condition of the connection reaction of embodiment 7 is:
[0129] temperature time 16℃ 60min 65℃ 10min 4℃ ∞
[0130] The ligation product was purified using the purification kit HiPure Nucleotide Remove Kit, the product was eluted with 25 μl of sterile ultrapure water, and 20 μl was taken for subsequent steps.
[0131] (4) performing asymmetric amplification on the probes 3A and 3B obtained in step (3) respectively to obtain a FISH probe library;
[0132] Asymmetric amplification reaction system:
[0133] Reagent Amount added 5X EpiMark Hot Start Taq Reaction Buffer 10μL dNTP Mixture (containing aminoallyl-dUTP) 3μL Epimark Hot stratTaq DNApolymerase 0.25 μL Nuclease-free water 14.75 μL Primer F (1μM) 1μL Primer R (20μM) 1μL Probe 3A or 3B 20 μL
[0134] Primer F and Primer R are:
[0135] name Base sequence (5'→3') Primer F CCTCTGTATGCGCATCCTGTGAT ...
Embodiment 1-9
[0147] Embodiment 1-9 is that on the basis of the basic embodiment, various parameters are adjusted to obtain the following embodiments:
[0148]
[0149]
[0150]
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


