Intelligent macrophage tumor targeting therapy system and preparation method and application thereof

A macrophage and reaction technology, applied in the field of biomedicine and nanomedicine, can solve the problems of low drug loading, limiting the therapeutic effect of macrophage drug carrier system, toxic and side effects, etc. Heat-responsive biotherapeutic factor release and growth-inhibiting effects

Active Publication Date: 2019-04-16
XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, uncontrolled secreted effector proteins may cause toxic side effects at sites other than the tumor
The low drug loading in cell carriers and the effect of drugs or nanocarriers on the intrinsic activity of carrier cells limit the therapeutic effect of macrophage drug carrier systems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Intelligent macrophage tumor targeting therapy system and preparation method and application thereof
  • Intelligent macrophage tumor targeting therapy system and preparation method and application thereof
  • Intelligent macrophage tumor targeting therapy system and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Preparation of amino mesoporous silicon nanomaterials coated with hyaluronic acid loaded with indocyanine green.

[0045] (1) Disperse cetyltrimethylammonium bromide (1.0 g) in double distilled water (480 mL), add sodium hydroxide (0.28 g), stir magnetically, heat the oil bath to 80 °C, add dropwise Tetraethyl orthosilicate (5.0 g), after continuous stirring for 2-3 hours, centrifuge (8000 rpm, 10 min) to collect the precipitate, wash with methanol and double distilled water once, and lyophilize in a low-temperature freeze dryer, namely The white powdery mesoporous silicon nanoparticles containing templates were obtained.

[0046] (2) Disperse the mesoporous silicon nanoparticles (1.0 g) obtained in step (1) in methanol (75 mL), add 3-aminopropyltriethoxysilane (2 mL) under magnetic stirring, and react at room temperature After 24 hours, the aminated mesoporous silicon nanoparticles were collected by centrifugation (8000 rpm, 10 min).

[0047] (3) Disperse ...

Embodiment 2

[0050] Example 2: Construction of a monocyte / macrophage cell line overexpressing the signal peptide TNFα.

[0051] (1) Using polymerase chain reaction (Polymerase Chain Reaction, PCR) to amplify the TNFα coding sequence without the signal peptide, and construct the overexpression non-secretion TNFα plasmid DNA by DNA recombination technology. Select plenti-CMV-puro-3×Flag as the carrier plasmid, and cut the plasmid with two restriction enzymes Sal1 and BamH1 (enzyme digestion system: double distilled water 3 μL; plenti-CMV-puro-3×Flag 10 μL; 10×Buffer T 3 μL; Sal1 enzyme 2 μL; BamH1 2 μL; enzyme digestion at 37°C overnight, store at -20°C). PCR technology was used to amplify the gene fragment EGFP coding sequence, wherein forward primer (5'-3'): CTAGATATCTTCGAAGGATCCACCATGGTGAGCAAGGG; reverse primer (5'-3'): ATCCAGAGGTTGATTGTCGACCTTGTACAGCTCGTCCATG. The amplified EGFP coding sequence gene is connected to the vector plenti-CMV-puro through a recombinase reaction, and transform...

Embodiment 3

[0055] Example 3: Existing form and activity detection of overexpressed TNFα protein in macrophages after genetic engineering.

[0056] L929 cells in the logarithmic growth phase were seeded in 96-well plates at 30,000 cells per well, and cultured for 24 hours. The culture supernatants of three kinds of macrophages (wild type, overexpressed EGFP protein, and overexpressed EGFP-TNFα protein) were collected respectively, and after cell counting, the cell suspension was prepared with PBS and lysed by liquid nitrogen freeze-thaw. The culture supernatant and freeze-thawed lysate of macrophages were added to L929 cells at 50,000, 100,000, and 200,000 respectively, and actinomycin D (0.5 μg / mL) was added at the same time, and cultured at 37°C for 48 hours. MTS detects the viability of L929 cells, the existence form and activity of TNFα protein such as image 3 As shown, the culture supernatant of M(ET) did not show cytotoxicity, but the cell lysate of M(ET) showed obvious cytotoxici...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a macrophage tumor targeting therapy system combining a photothermal therapy effect and photo-thermally responsive biotherapeutic factor release and preparation and application thereof. The unique spatial and temporal selectivity of the macrophage tumor targeting therapy system can direct at a variety of solid malignant tumors, combines tumor photo-thermal therapy with biological therapy to achieve the local targeted comprehensive treatment of the tumors and reduce the toxic and side effects of traditional treatment caused by an off-target effect. The macrophage targeting tumor system can effectively inhibit the tumor growth of mice and prolong the survival time of the tumor-bearing mice, is an excellent tumor-targeting biological preparation and has great clinicalconversion application prospects.

Description

technical field [0001] The invention belongs to the technical field of biomedicine and nanomedicine, and relates to a macrophage tumor-targeted therapy system combined with photothermal therapy effect and photothermal responsive biotherapeutic factor release, as well as its preparation and application. The unique spatiotemporal selectivity of this macrophage tumor targeting therapy system can target a variety of solid malignant tumors, combined with tumor photothermal therapy and biological therapy, to achieve local targeted comprehensive treatment of tumors, and reduce the traditional treatment due to off-target effects. toxic side effect. The macrophage-targeting tumor system can effectively inhibit the growth of tumors in mice and prolong the survival of tumor-bearing mice. It is an excellent tumor-targeting biological agent and has great prospects for clinical transformation. Background technique [0002] Malignant tumors are still one of the primary diseases threatenin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K41/00A61K47/46A61K47/36A61K47/04A61P35/00
CPCA61K41/0057A61K47/02A61K47/36A61K47/46A61P35/00
Inventor王征王琳黄雷颜雯茜
OwnerXIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV