Recombinant plasmid and preparation method thereof, and preparation method and applications of cell prepared by using recombinant plasmid and capable of expressing high temperature-resistant alpha-amylase

A technology of recombining plasmids and high temperature resistance, which is applied in the field of biological genetic engineering to achieve the effects of fast production speed, increased yield, and clear genetic information

Active Publication Date: 2019-06-04
广州睿辰生物科技有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Bacillus amyloliquefaciens used to be the production engineering bacteria of mesophilic α-amylase, but in the later stage of cultivation, due to the change of nutritional structure and the accumulation of metabolites, Bacillus amyloliquefaciens began to form spores, that is, it no longer continued to produce high-temperature resistant α-amylase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid and preparation method thereof, and preparation method and applications of cell prepared by using recombinant plasmid and capable of expressing high temperature-resistant alpha-amylase
  • Recombinant plasmid and preparation method thereof, and preparation method and applications of cell prepared by using recombinant plasmid and capable of expressing high temperature-resistant alpha-amylase
  • Recombinant plasmid and preparation method thereof, and preparation method and applications of cell prepared by using recombinant plasmid and capable of expressing high temperature-resistant alpha-amylase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A kind of recombinant plasmid, the gene sequence that it contains is shown as SEQ ID NO: 3, and described recombinant plasmid is with Bacillus subtilis-E. P43 promoter and lacO gene, and LacI gene inserted at its NheI and PvuI multiple cloning sites.

[0051] The preparation method of the recombinant plasmid comprises the following steps:

[0052] (1) Using the Bacillus subtilis-Escherichia coli shuttle plasmid pBE2 vector as the backbone, use EcoRI and BamHI to carry out double enzyme digestion overnight, and recover the plasmid fragment after digestion;

[0053] (2) Using Bacillus subtilis as a template, use the primer P1 containing the EcoRI restriction site and the primer P2 containing the lacO and BamHI restriction site to amplify the P43 promoter sequence to obtain the lacO gene connected to the promoter P43 ; Its gene sequence is shown in SEQ ID NO: 1, and the connection schematic diagram is shown in Figure 1;

[0054] The gene sequences of the primers P1, P2, P4...

Embodiment 2

[0072] A method for preparing cells capable of expressing high-temperature-resistant α-amylase, the preparation method comprising the following steps:

[0073] (a) Ligate the high temperature resistant α-amylase gene into the recombinant plasmid in Example 1, and transform the ligated product into Escherichia coli DH5a, and use neomycin for resistance screening to obtain the high temperature resistant α-amylase gene Gene carrier; specifically:

[0074] (a-1) According to the Bacillus subtilis thermostable α-amylase gene sequence published by NCBI, design primers, use Bacillus subtilis strain as template, use primer P5 with BamHI restriction site and XbaI enzyme The primer P6 at the cleavage site amplifies the high temperature resistant α-amylase gene, and the obtained high temperature resistant α-amylase gene sequence is shown in SEQ ID NO:4.

[0075] The gene sequences of the primers P5 and P6 are as follows:

[0076] P5: CG GGATCC ACATTGAAAGGGGAGGAGAAT;

[0077] P6: GC ...

Embodiment 3

[0090] Application of cells capable of expressing thermostable α-amylase in production of thermostable α-amylase

[0091] Add the cells capable of expressing high-temperature-resistant α-amylase obtained in Example 2 into a Erlenmeyer flask filled with 50 mL of LB culture medium at a ratio of 1:100, and culture with shaking at 37°C and 250 r / min for 16 hours. Collect the culture supernatant for SDS-PAGE, such as Figure 4 As shown in the figure, one more band around 50KD can be seen in the figure, indicating that the recombinant amylase gene has been expressed in the cell.

[0092] Enzyme extraction and purification: collect the fermentation broth, centrifuge at 3000r / min for 10min, remove the bacteria, add 65% saturated ammonium sulfate to the supernatant, wait until the ammonium sulfate is fully dissolved, salt out at 4°C for 2 hours, then 5000r / min min and centrifuged for 30 min to obtain the crude enzyme that was initially purified.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant plasmid and a preparation method thereof, and a preparation method and applications of a cell prepared by using the recombinant plasmid and capable of expressinghigh temperature-resistant alpha-amylase. Firstly, a recombinant plasmid containing a P43 promoter and lacO and lacI genes is prepared; then the high temperature-resistant alpha-amylase gene is connected to the recombinant plasmid, the plasmid contains a bacillus subtilis strong promoter P43 so as to greatly improve the yield of high temperature-resistant alpha-amylase, meanwhile, the sequences ofthe lacO and lacI genes contained in the plasmid can be subjected to induced expression by using IPTG, and the induced expression is faster and more targeted than microbial mutagenesis breeding; andthen a receptor cell and a vector containing the high temperature-resistant alpha-amylase gene are subjected to electric shock transformation so as to obtain the cells capable of expressing the high temperature-resistant alpha-amylase. When bacillus subtilis is used as the receptor cell, the gene information is clear, the production speed is high, the culture density is high, and the yield and enzyme activity of alpha-amylase can be improved.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, and specifically relates to a recombinant plasmid, a preparation method thereof, and a preparation method and application of a cell capable of expressing high-temperature-resistant alpha-amylase prepared by using the recombinant plasmid. Background technique [0002] High-temperature α-amylase is an enzyme widely distributed in animals, plants and microorganisms, which can hydrolyze α-1,4 glycosidic bonds of starch, glycogen, etc., and generate dextrin and reducing sugar. Due to the terminal residue of the product The carbon atom configuration is α configuration, so it is called high temperature α-amylase. [0003] In 1872, Bacillus was first proposed as an expression host. At present, people have done a lot of research on Bacillus, especially in the fields of strain improvement, genetic manipulation, competence, spore formation and its regulation. Bacillus that can be used as a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/75C12N15/66C12N1/21C12N9/28C12R1/125
Inventor周辉
Owner广州睿辰生物科技有限公司