Kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss
A kit and gene technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of inability to determine the reliability of hearing loss characteristics, small number of patients, etc., and achieve the effect of reducing the burden and reducing the birth rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0043] Collect all kinds of sensorineural deafness patients through the deaf clinic and resource collection network, and establish a resource library. On the premise that the patient is voluntary, after signing the informed consent, blood samples are collected, and an outpatient medical record database is established to record the patient's condition, family history and contact information in detail. Then, the genomic DNA was extracted by protease degradation, quantified and stored at -20°C. Each DNA sample corresponds to the registered patient's clinical data in detail. Then, use the online primer design software Primer5.0 to design primers (the amplification target region is the No. 27 exon of the DIAPH1 gene and its cut position, reference sequence: Gene ID: 1729, the size of the amplification target fragment is 701bp), and the genome DNA was used as a template, and PCR amplification was performed on a BIORAD My Cycle thermal cycler. Direct sequencing of PCR amplification ...
example 2
[0148] The amplification primers (the design was completed in September 2018) are as follows, and the others are the same as Example 1 (the amplified target region is exon 27 of the DIAPH1 gene and its cut position, reference sequence: Gene ID: 1729):
[0149] Upstream primer DIAPH1-F-2: 5'-CCCTGCTCTGAAACCTAACC-3',
[0150] Downstream primer DIAPH1-R-2: 5'-TACTCTGTAACATGGGAAGAA-3'.
[0151] The Fourth Military Medical University of the Chinese People's Liberation Army
[0152] Delayed-onset sensorineural deafness gene DIAPH1 mutation detection kit
[0153] 4
[0154] 1
[0155] 20
[0156] DNA
[0157] Synthetic
[0158] 1
[0159] cttggagttgggcagttgta 20
[0160] 2
[0161] 20
[0162] DNA
[0163] Synthetic
[0164] 2
[0165] aaatgccaac tcaaatccct 20
[0166] 3
[0167] 20
[0168] DNA
[0169] Synthetic
[0170] 3
[0171] ccctgctctg aaacctaacc 20
[0172] 4
[0173] 21
[0174] DNA
[0175] Synthetic
[0176] 4
[0177] tactctgt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


