Kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss

A kit and gene technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of inability to determine the reliability of hearing loss characteristics, small number of patients, etc., and achieve the effect of reducing the burden and reducing the birth rate

Active Publication Date: 2019-06-07
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in most literatures, the number of patients in the family is small, and it is greatly affected by factors such as the environment, so it is impossible to determine the reliability of the characteristics of hearing loss
There is no report on the DIAPH1 gene NM_001314007:c.3575-2A>G mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss
  • Kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss
  • Kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0043] Collect all kinds of sensorineural deafness patients through the deaf clinic and resource collection network, and establish a resource library. On the premise that the patient is voluntary, after signing the informed consent, blood samples are collected, and an outpatient medical record database is established to record the patient's condition, family history and contact information in detail. Then, the genomic DNA was extracted by protease degradation, quantified and stored at -20°C. Each DNA sample corresponds to the registered patient's clinical data in detail. Then, use the online primer design software Primer5.0 to design primers (the amplification target region is the No. 27 exon of the DIAPH1 gene and its cut position, reference sequence: Gene ID: 1729, the size of the amplification target fragment is 701bp), and the genome DNA was used as a template, and PCR amplification was performed on a BIORAD My Cycle thermal cycler. Direct sequencing of PCR amplification ...

example 2

[0148] The amplification primers (the design was completed in September 2018) are as follows, and the others are the same as Example 1 (the amplified target region is exon 27 of the DIAPH1 gene and its cut position, reference sequence: Gene ID: 1729):

[0149] Upstream primer DIAPH1-F-2: 5'-CCCTGCTCTGAAACCTAACC-3',

[0150] Downstream primer DIAPH1-R-2: 5'-TACTCTGTAACATGGGAAGAA-3'.

[0151] The Fourth Military Medical University of the Chinese People's Liberation Army

[0152] Delayed-onset sensorineural deafness gene DIAPH1 mutation detection kit

[0153] 4

[0154] 1

[0155] 20

[0156] DNA

[0157] Synthetic

[0158] 1

[0159] cttggagttgggcagttgta 20

[0160] 2

[0161] 20

[0162] DNA

[0163] Synthetic

[0164] 2

[0165] aaatgccaac tcaaatccct 20

[0166] 3

[0167] 20

[0168] DNA

[0169] Synthetic

[0170] 3

[0171] ccctgctctg aaacctaacc 20

[0172] 4

[0173] 21

[0174] DNA

[0175] Synthetic

[0176] 4

[0177] tactctgt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for DIAPH1 mutation detection, a pathogenic gene of delayed sensorineural hearing loss. The kit includes reagents for extracting DNA from samples to be tested, PCR reaction reagents for amplifying DNA samples and reagents for sequencing PCR amplification products; and the PCR reaction reagents for amplifying DNA samples include PCR primers. The kit of the invention isused to detect whether patients have NM_001314007:c.3575-2A>G mutation in DIAPH1 gene, so as to diagnose the cause of delayed sensorineural hearing loss. Therefore, the kit is helpful for the development of clinical screening of DIAPH1 mutation in patients with delayed sensorineural hearing loss, providing a basis for the diagnosis of delayed sensorineural hearing loss.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a detection kit for c.3575-2A>G typing of a single mutation site of DIAPH1 gene used in clinical diagnosis of delayed-onset sensorineural deafness. Background technique [0002] DIAPH1 is the causative gene of DFNA1 type deafness identified by Lynch et al. in 1997. In the past 20 years, several families with hereditary deafness caused by DIAPH1 gene mutations have been reported. Most of the patients showed delayed hearing loss with or without hematological abnormalities. In addition, mutations in the DIAPH1 gene have also been found to be associated with autosomal recessive microcephaly syndrome. Hereditary deafness has obvious phenotypic diversity and genetic heterogeneity. The full name of DIAPH1 gene (OMIM:602121) is diaphanousrelatedformin1, other names include: DIA1, DRF1, DFNA1, LFHL1, SCBMS, hDIA1, located at 5q31.3, genomic position chr5:141,515,021-141,619,055, full-le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/11
CPCY02A50/30
Inventor查定军王淑娟温立婷梁鹏飞林颖陈俊韩宇李薇李琼邱建华
OwnerFOURTH MILITARY MEDICAL UNIVERSITY