Application of Heat Shock Protein Gene from Thermophilic Bacteria

A technology of heat shock protein and thermophilic bacteria, applied in the field of microbial engineering, can solve the problems of affecting riboflavin production, poor strain tolerance, high energy consumption, etc.

Active Publication Date: 2020-10-02
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the industry mainly uses Bacillus subtilis to produce riboflavin, which has the following defects: the one is high energy consumption
Second, the strain tolerance is poor
During the fermentation process, due to various unfavorable conditions such as heat, osmotic pressure, acidification of the medium, and the production of toxic metabolites, the protein in the strain is denatured, which greatly affects the production of riboflavin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Heat Shock Protein Gene from Thermophilic Bacteria
  • Application of Heat Shock Protein Gene from Thermophilic Bacteria
  • Application of Heat Shock Protein Gene from Thermophilic Bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] The construction of the engineering bacteria of embodiment 1 high temperature riboflavin

[0064] 1. Construction of the carrier

[0065]Use pUCG3.8 (Reeve et al. 2016) as the vector backbone. Using PDB1s (Lin et al.2015) as the template for PCR amplification, the primer 6.0 software was used to design and amplify the addA primer aadA-F:TCTAAAATTTATCTGAAAAGGGAATGAGGGAAGCGGTGATCGC aadA-R:AACGCGCGAGCGATCGCTCATTTGCCGACTACCTTGGTG, and a fragment containing aadA spectinomycin resistance was amplified by PCR. The pUCG3.8 vector backbone and aadA spectinomycin-resistant fragment were assembled into plasmid pUCG3.8-spe using Gibson assembly (Gibson et al. 2009). Using the pHCMC04 (Reeve et al. 2016) plasmid as a template, use primer 6.0 software to design and amplify repA primers, repA-F: TGATCTTTTTCTACCTCGAGGAGAATTAAGAAAGACATGG, repA-R: TCTTCATCGGCGGCGCGCCAAACAAGCCTCAGATGTG, and amplify repA from Bacillus subtilis as an insert. Using pUCG3.8-spe as a template, use primer 6.0...

Embodiment 2

[0073] The impact of embodiment 2 high temperature on recombinant bacteria

[0074] 1. Determination of cell concentration

[0075] In order to more accurately determine the impact of high temperature on the strain, two schemes were adopted to determine the cell concentration. Scheme A: Inoculate a single clone into a 250mL Erlenmeyer flask containing 50mL LB medium, culture at 39°C, 220rpm for 12h, then take the fermentation broth and transfer it to a 250mL Erlenmeyer flask containing 50mL LB medium to inoculate the The inoculum with the initial OD value of the medium was 0.1 for transfer. After the transfer, first culture at 41°C and 220rpm for 12h, and then increase the culture temperature by 2°C every 12h until the culture temperature reaches 49°C after 60h of culture. During this process, samples were taken every 12 hours, and the OD was measured using a spectrophotometer 600 The blank control is the culture medium without cells. The difference between plan B and plan...

Embodiment 3

[0080] The impact of embodiment 3 hyperosmotic pressure on recombinant bacteria

[0081] The growth of B. subtilis 446 in the fermentation process is easily affected by the high osmotic pressure brought by the fermentation product riboflavin. Strains B.s446-HSP20-3, B.s446-HSP20-2 and B.s446-PtDnaK-PtDnaJ-PtGrpE containing heat shock proteins were cultured in hypertonic medium containing 10% sodium chloride at 37°C, simulating Hyperosmotic environment during strain fermentation.

[0082] To determine the cell viability of strains B.s446-HSP20-3, B.s446-HSP20-2, and B.s446-PtDnaK-PtDnaJ-PtGrpE under hypertonic conditions, inoculate single clones into 250 mL cones containing 50 mL LB medium. In a conical flask, culture at 37°C and 220rpm for 12h, then take the fermentation broth and transfer it to a 250mL Erlenmeyer flask containing 50mL LB medium. Then continue to culture at 37°C and 220rpm for 12 hours, then add NaCl to the culture medium during the exponential growth phase ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a heat shock protein gene from thermophilic bacteria, in particular to application in riboflavin fermentation production. Firstly, the thermophilic heat shock protein (HSP) proximal to bacillus subtilis is found by bioinformatics analysis, and then a gene encoding HSP is introduced into bacillus subtilis (B.subtilis 446) in the form of plasmid, fermentation isexecuted under different temperature and tolerance conditions, engineering strain growth, strain viability, temperature tolerance, osmotic pressure tolerance and other indicators are detected, and accordingly a suitable heat shock protein element and an engineering strain with improved performance are screened. An experimental result shows that heterologous expression of heat shock protein gene from thermophilic bacteria in B.subtilis 446 can increase the fermentation temperature, reduce energy consumption, increase the yield of riboflavin and meanwhile shorten a fermentation period.

Description

technical field [0001] The invention belongs to the technical field of microbial engineering, in particular, it relates to the application of heat shock protein gene derived from thermophilic bacteria. Background technique [0002] Riboflavin (Riboflavin) also known as vitamin B 2 (Vitamin B 2 ), is an essential vitamin to maintain the normal substance metabolism of human and animal organisms. It exists in two forms of FAD and FMN in the human body, participates in the oxidation-reduction reaction in the body, and plays the role of hydrogen delivery. Because animals and humans cannot synthesize riboflavin by themselves, riboflavin needs to be supplemented in an appropriate amount, so riboflavin can be used as a pigment and food additive in the food industry and a feed additive in the feed industry. [0003] At present, the industrial production methods of riboflavin are mainly chemical semi-synthesis and microbial fermentation. Compared with the chemical synthesis method,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C12N1/21C12N15/75C12P25/00C12R1/125
Inventor李子龙王俊阳范可强王为善王绘砖袁昉徐珍
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI