Application of an insect detoxifying enzyme protein in degrading organophosphorus pesticides

A technology for detoxifying enzymes and pesticides, which is applied to the application field of insect glutathione-S transferase protein in the degradation of malathion, and can solve problems such as the inability to remove malathion pesticide residues and the like

Active Publication Date: 2022-05-31
SHANXI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enzyme does not degrade malathion, so it cannot solve the problem of removing malathion pesticide residues, so other methods need to be found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of an insect detoxifying enzyme protein in degrading organophosphorus pesticides
  • Application of an insect detoxifying enzyme protein in degrading organophosphorus pesticides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Example 1: Obtaining the LmGSTpcF1 gene of migratory locust

[0012] Using the cDNA of the resistant strain migratory locust as a template, use primers: FF 5'-3': ATGCCAGTCACCCTC, and FR 5'-3': CTACGGAGCCAGATG to clone the full-length LmGSTpcF1 gene. The system is: 2×Taq PCR MasterMix (25 μL), DNA template (1 μL), primers (1 μL each), ddH 2 O (21 μL), a total of 50 μL. After the product was recovered, purified and sequenced, SEQ ID NO:1 was obtained.

Embodiment 2

[0013] Example 2: Expression and purification of LmGSTpcF1

[0014] According to SEQ ID NO: 1, primers including BamHI and HindIII restriction sites were designed, WF5'-3': TAGGATCCATGCCAGTCACCCTC and WR5'-3': ATAAGCTTCTACGGAGCCAGATG were used for recombinant plasmid construction. After PCR, the product was digested with BamHI and HindIII, and recovered by 1.5% agarose gel electrophoresis. The prokaryotic expression vector pET28a was also processed synchronously. After the recovered products were mixed, buffer and T4 ligase were added, ligated overnight at 4°C, and transformed into Escherichia coli DH5α competent cells. Select the strains with accurate verification results, expand the culture, extract the recombinant plasmid, and transform it into Escherichia coli BL21 (DE3) competent cells. Pick positive colonies, after PCR verification, expand culture. Positive monoclonal colonies were inoculated into liquid LB medium (containing 50 μg·mL -1 Kanamycin) test tubes, cultiv...

Embodiment 3

[0016] Example 3 Metabolism detection of malathion by LmGSTpcF1

[0017] The peak area of ​​pesticides detected by HPLC was used to calculate the degree of metabolism of malathion by LmGSTpcF1. The chromatographic detection condition is that mobile phase A is acetonitrile, and B is 0.1% formic acid water. The elution gradient is A:B=80:20 isocratic elution for 8 minutes; the detection wavelength is 210nm; the column temperature is 35°C; the sample volume is 2uL; the flow rate is 0.2mL / min.

[0018] The test samples were divided into two groups, A and B. Group A was the normal response group (LmGSTpcF1+GSH+malathion); group B was the protein-free control group (PBS+GSH+malathion) with PBS buffer instead of protein. The 200uL reaction solution includes: 20uL 1.6mg / mL LmGSTpcF protein (32ug); 15uL 20mg / mL malathion (300ug), 10uL 50mM GSH (2.5mM), PBS to make up the volume to 200uL. After mixing the reaction solution, place it at 27°C, 1200r / min, and incubate for 3h; after the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the application of insect detoxifying enzymes in pesticide degradation, specifically the application of migratory locust detoxifying enzyme LmGSTpcF1 in degrading malathion pesticide, the amino acid sequence of migratory locust detoxifying enzyme LmGSTpcF1 is shown in SEQ ID NO: 2 sequence. LmGSTpcF1 was incubated with GSH and malathion under reaction conditions, and malathion was detected by liquid chromatography. The results showed that malathion was basically completely degraded, no pesticide residues could be detected, and the degradation efficiency reached over 99%. . The migratory locust detoxifying enzyme LmGSTpcF1 of the invention can be used for removing malathion pesticide residues in agricultural products, water sources, soil and the like.

Description

technical field [0001] The invention relates to the application of insect detoxifying enzymes in the degradation of pesticides, in particular to the application of insect glutathione-S transferase protein in the degradation of malathion. Background technique [0002] In my country, malathion is widely used in pest control due to its advantages of high efficiency, low toxicity and broad-spectrum insecticidal properties. Since the target of malathion is acetylcholinesterase (AChE), it can affect the nervous system of mammals and humans, thereby causing harm. Long-term unreasonable and excessive use of malathion not only greatly increases its pesticide residues in the environment, but also causes insecticide resistance in insects, which further leads to the widespread use of pesticides. If things go on like this, malathion pesticide residues in the environment will affect food safety and people's health, and it needs to be treated harmlessly. [0003] How to remove pesticide ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54A62D3/02A62D101/04A62D101/28
CPCC12N9/1088A62D3/02C12Y205/01018A62D2101/04A62D2101/28Y02A50/30
Inventor张建琴马雯乔玉琪秦雪梅
OwnerSHANXI UNIV