Phosphotransketolase with increased activity and its application in the production of metabolites

A technology of phosphoketolase and metabolites, applied in the field of genetic engineering, can solve the problems of low F/XPK enzyme activity and limited application potential

Active Publication Date: 2020-06-23
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The natural F / XPK enzyme activity is low, and a large amount of overexpression is required to show the effect, which limits its application potential

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phosphotransketolase with increased activity and its application in the production of metabolites
  • Phosphotransketolase with increased activity and its application in the production of metabolites
  • Phosphotransketolase with increased activity and its application in the production of metabolites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0123] Example 1. Construction of a strain that knocks out the pfk gene, i.e. strain Z188△pfk

[0124] Corynebacterium glutamicum Z188, namely Corynebacterium glutamicum Z188. The complete genome of Corynebacterium glutamicum Z188 can be found in GenBank accession number: NZ_AKXP00000000.1 (https: / / www.ncbi.nlm.nih.gov / nuccore / NZ_AKXP00000000). The pfk gene is the 6-phosphofructokinase gene. In the genomic DNA of Corynebacterium glutamicum Z188, the nucleotide sequences of the coding frame of the pfk gene and the 1000bp parts upstream and downstream thereof are shown in sequence 2 of the sequence listing (in the sequence 2 of the sequence listing, 1001-2041 nucleotides is a coding frame, encoding the protein shown in Sequence 1 of the Sequence Listing).

[0125] Δpfk-F1: CCTC GAATTC GGATGCTGCCAATGGAATGGTGCCCAGTG;

[0126] Δpfk-R1: CTTCAAGGTT AAATTCATTGCTGGCTGTGC;

[0127] Δpfk-F2: CAATGAATTT AACCTTGAAGGAAGTTCCATTC;

[0128] Δpfk-R2: TCTA CTGCAG GGAATGATGACACCGATGGTGT...

Embodiment 2

[0137] Embodiment 2, preparation and growth performance of recombinant bacteria

[0138] The phosphoketolase derived from Bifidobacterium adolescentis is shown in sequence 3 of the sequence list. The complete codon optimization is carried out on the gene encoding the protein shown in sequence 3 of the sequence listing, and the optimized gene is shown in sequence 4 of the sequence listing. The phosphoketolase shown in sequence 3 of the sequence listing is also called FXPK protein or F / XPK protein. The gene encoding FXPK protein is also called fxpk gene.

[0139] 1. Preparation of recombinant plasmids

[0140] 1. Synthesize the double-stranded DNA molecule shown in sequence 4 of the sequence table; use the synthesized double-stranded DNA molecule as a template, perform PCR amplification with a primer pair composed of F1 and R1, and recover the PCR amplification product.

[0141] F1: CTAC GAATTC GAAGGAGATATACATATG;

[0142] R1: TCAG GGATCC TCATTCGTTGTCACCCGCGGTC.

[0143...

Embodiment 3

[0157] Embodiment 3, obtain the mutein that enzyme activity improves

[0158] 1. Construction of the fxpk gene mutant library

[0159] 1. Using the recombinant plasmid pTR-fxpk as a template, the primer pair composed of F1 and R1 is used for error-prone PCR amplification. Error-prone PCR amplification, using DNA polymerase (Beijing Quanshijin Biology). Three reaction systems were set up, respectively containing 0.2mM, 0.5mM or 0.8mM manganese chloride. After completing the error-prone PCR amplification, the three reactions were combined.

[0160] 2. Take the product of step 1, perform double digestion with restriction endonucleases EcoRI and BamHI, and recover the digested product.

[0161] 3. Take the recombinant plasmid pTR-fxpk, perform double digestion with restriction endonucleases EcoRI and BamHI, and recover the vector skeleton.

[0162] 4. Ligate the digested product of step 2 with the vector backbone of step 3 to obtain a recombinant plasmid.

[0163] 5. Introd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phosphoketolase with improved activity and its use in the production of metabolites. The protein provided by the present invention is a mutant protein, which is a protein obtained by subjecting phosphoketolase to any one or more of the following mutations: the second position is mutated from T to A; the sixth position is mutated from I to T; the 14th position The position is mutated from N to D; (the 20th position is mutated from E to D; the 120th position is mutated from T to A; the 231st position is mutated from E to K; the 260th position is mutated from H to Y; the 342nd position is mutated from E It is K; the 397th position is mutated from K to R; the 676th position is mutated from D to G; the 785th position is mutated from F to L; the 801st position is mutated from W to R. The present invention also protects the mutant protein when preparing metabolites Application in. Compared with the existing phosphoketolase, the phosphoketolase activity of the mutant protein provided by the invention is significantly increased, thereby significantly increasing the yield of target metabolites.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a phosphoketolase with improved activity, and the application of the phosphoketolase in the production of metabolites, the metabolites involved include but not limited to amino acids (especially amino acids derived from acetyl-CoA ), succinic acid, citric acid, etc. Background technique [0002] Amino acids, organic acids, are the most important ingredients in human and animal nutrition, and play a very important role in industries such as medicine, health, food, chemical industry, animal feed and cosmetics. Currently, amino acids and organic acids are mainly produced by microbial fermentation. Known microorganisms that can produce amino acids include Escherichia, Corynebavterium, and Brevibacterium. In recent years, with the development of genetic engineering technology, strains have been genetically modified by means of genetic engineering, and a large number of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C07K19/00C12N15/62C12P21/00
CPCC07K2319/00C12N9/1022C12P21/00C12Y202/01001
Inventor孙际宾李庆刚郑平周文娟张晓立德莱奥西班乔·泰沃马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI