A kind of stress resistance-related protein and its coding gene and application
A technology related to protein and stress resistance, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as difficulties in genetic experiments, achieve enhanced drought resistance and salt-alkaline tolerance, and improve plant drought resistance and salt tolerance sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] Example 1: Cloning and sequencing of the MsNTF2 gene
[0074] Include the following steps:
[0075] The experimental material used in this example is the alfalfa No. 1 alfalfa. Select 10 healthy and plump seeds, use the double-layer filter paper germination method, germinate at 25°C for 5 days until the cotyledons unfold, transfer them to 1 / 2MS hydroponic nutrient solution, and change the nutrient solution every two days. After 7 days, sodium chloride was added to the 1 / 2MS nutrient solution until the final concentration of sodium chloride was 150mmol / L, and treated for 24 hours. The ground and underground samples were quickly sampled respectively, quickly frozen in liquid nitrogen, and stored at -80°C for later use.
[0076] The RNA of the samples was extracted by the Trizol method, and the RNA was reverse-transcribed into cDNA using a cDNA synthesis reverse transcription kit. The total volume of the PCR amplification system is 50 μl, including 5×Phusion HF Buffer 10...
Embodiment 2
[0080] Example 2: Real-time fluorescent quantitative PCR analysis of the expression characteristics of MsNTF2
[0081] Including the following steps:
[0082] Alfalfa seed germination and hydroponic method are the same as embodiment 1. The alfalfa seedlings of 12 days old are processed as follows:
[0083] Drought treatment: Add mannitol to 1 / 2MS hydroponic nutrient solution to a final concentration of 500mmol / L, and treat for 0, 1, 3, 6, 12 and 24 hours respectively. The ground and underground samples were taken separately, quick-frozen in liquid nitrogen, and stored at -80°C for later use.
[0084] Salt treatment: Add sodium chloride to the 1 / 2MS hydroponic nutrient solution to a final concentration of 150mmol / L, and treat for 0, 1, 3, 6, 12 and 24 hours respectively. The ground and underground samples were taken separately, quick-frozen in liquid nitrogen, and stored at -80°C for later use.
[0085] ABA (phytohormone abscisic acid) treatment: ABA was added to 1 / 2MS hydro...
Embodiment 3
[0089] Example 3: MsNTF2 subcellular localization analysis
[0090] Including the following steps:
[0091] 1. Material preparation
[0092] Take an appropriate amount of Nicotiana benthamiana seeds, put them in a centrifuge tube and soak them in distilled water for 2 hours, sow them in the soil with a pipette, and the plants can be used as transformation recipients after 6 to 7 weeks.
[0093] 2. Construction of subcellular vectors
[0094] Primers MsNTF2-GFP-F and MsNTF2-GFP-R were designed according to the sequence of the MsNTF2 gene, and the 5' ends of the primers were introduced into XhoI and Sal I restriction sites respectively:
[0095] (SEQ ID NO.10) MsNTF2-GFP-F (5'-3'): gcctcgagatggatgctggaaaagagactag
[0096] (SEQ ID NO.11) MsNTF2-GFP-R(5'-3'): gcgtcgactcaaacagttggatccttccc
[0097] Using the alfalfa cDNA in Example 1 as a template, PCR amplification was performed using MsNTF2-GFP-F and MsNTF2-GFP-R. The total volume of the PCR amplification system is 50 μl, in...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More