In-situ hybridization probe primer, probe and mapping method of muscle satellite cell of sebastes schlegeli

A muscle satellite cell and in situ hybridization technology is applied in the field of in situ hybridization probe primers for muscle satellite cells of Xu's flat scorpionfish, which can solve the problems of unclear mechanism and the like

Active Publication Date: 2020-05-08
OCEAN UNIV OF CHINA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In adult fish, the proliferation and differentiation of muscle satellite cells are always in an active state, which is regulated differently from mammals, but the mechanism is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-situ hybridization probe primer, probe and mapping method of muscle satellite cell of sebastes schlegeli
  • In-situ hybridization probe primer, probe and mapping method of muscle satellite cell of sebastes schlegeli
  • In-situ hybridization probe primer, probe and mapping method of muscle satellite cell of sebastes schlegeli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] A method utilizing transmission electron microscopy to locate muscle satellite cells in the muscle of the scorpionfish Xu's, the specific steps of the method are as follows:

[0025] 1. Sampling and washing. Take a 1-year-old flat scorpionfish with a clean and sterile blade above the lateral line, close to the skeletal muscle in the middle of the dorsal fin, cut into small pieces about 1mm wide and 2-3mm long, and rinse with excess RNase-free 1xPBS buffer. The washed muscle samples were stored overnight at 4°C in 2.5% glutaraldehyde;

[0026] 2. After 0.1mol L -1 After rinsing with phosphate buffer, transfer to 1% osmic acid and fix at 4°C for 3h.

[0027] 3. Dehydration. 50% ethanol, 15-20min; 70% ethanol, 15-20min; 90% ethanol, 15-20min; 90% ethanol, 90% acetone (1:1) 15-20min; 90% acetone, 15-20min. All the above operations were carried out at 4°C. Dehydrate in 100% acetone at room temperature three times, each time for 15-20min.

[0028] 4. Embedding. Pure ac...

Embodiment 2

[0031] Embodiment 2 A probe primer for in situ hybridization of Xu's flat scorpion muscle satellite cells, the primer sequence is as follows: F: 5'-GGACAGGCCTACTAAAG-3', R: 5'-CCATGACAAACAGGAAC-3'; synthesized using the above primers Probe, the probe sequence is:

[0032]GGACAGGCCTACTAAAGCCCCCCCACCCCACCCCTAGGTCGCACCCTGCGCCACTCTCCTCCGCCCTCTGCCACCCTCCTCCATGCTCCATCAAGTCTGGACTCCCAACTCCAGCTCGCTCTGCAGCCGGGCCATGACATCAGCGCACAGACACGCAGCCTCGCTGAGAGAAAGTGACGCTCGCGAGTGTGACAAAAGCACTTCGGGGGAATGGAACTAAAGTTTTCACGCCATTGTCAACCACCAGGCGGCTCTGCACCCTCTCTTCTCAACCTTTTAGGCGTCTCTGCCTGTTCCCTGTACTCTCCTTCCTCCAGCCCCAAACCCTGCTTTGTTTTCCCCCAGAAGGCCAGACGGGATCCAAGTTCAACCGAGGATGGTCGGCCGCCTTGGCCCGGGTTCCTGTTTGTCGTGG

[0033] Utilize above-mentioned probe to carry out in situ hybridization localization method to Xu's flat scorpion muscle satellite cell, concrete steps are as follows:

[0034] 1) In situ hybridization sample fixation. Take the skeletal muscle sample from the same position on the other side of the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an in-situ hybridization probe primer, a probe and a mapping method of the muscle satellite cell of sebastes schlegeli and belongs to the field of molecular biology. A probe template has a primer sequence as shown in SEQ. NO 1 and SEQ. NO 2 and has a probe sequence as shown in SEQ. NO 3. The invention further provides a method for performing in-situ hybridization mapping on the muscle satellite cell of sebastes schlegeli by utilizing the probe. According to the method, the muscle satellite cell of sebastes schlegeli is mapped through skeletal muscle tissue in-situ hybridization of a Pax7 gene, theoretical and technical support can be provided to molecular mechanism study for exploring updating and activating of the muscle satellite cell, and further study on a muscle growth differentiation rule of sebastes schlegeli is favored. Furthermore, the method has a certain application prospect in the aspects of gene mapping and functional study on muscle tissue in-situhybridization of other fishes.

Description

technical field [0001] The invention belongs to the field of marine fish muscle growth and development, and relates to an in-situ hybridization probe primer, probe and positioning method of Xu's flat scorpion muscle satellite cells. Background technique [0002] Sebastes schlegelii is known as the "northern grouper". Its meat is delicious and has high economic value. It is an important marine economic fish and an excellent species for breeding. East China Sea. Xu's flat scorpionfish has a wide range of living temperatures and can survive the winter in deep-water cages. It is one of the few species suitable for long-term farming in deep-water cages in the north. It has been widely used in deep-water cage culture in the northern coast. [0003] Fish muscles make up 40-60% of the body weight and are the main edible part. For large economically important fishes such as the flat scorpionfish, muscle growth is the core of growth traits. Different from the muscle growth pattern ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/6841
CPCC12Q1/6841C12Q2527/125C12Q2543/10
Inventor贺艳齐洁王梦娅张全启
OwnerOCEAN UNIV OF CHINA