Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for synthesizing nucleic acid drug conjugate

A technology for drug conjugates and nucleic acid drugs, which can be used in drug combinations, pharmaceutical formulations, medical preparations with inactive ingredients, etc., and can solve problems such as increased synthesis costs, limitations, and reduced synthesis efficiency.

Pending Publication Date: 2020-06-02
RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, solid-phase synthesis itself is limited by the length of DNA. As the length of DNA increases, the synthesis efficiency decreases and the synthesis cost increases.
Synthesis of long-chain or bispecific Aptamers by solid-phase synthesis is unfavorable due to low synthetic yields and relatively high costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing nucleic acid drug conjugate
  • Method for synthesizing nucleic acid drug conjugate
  • Method for synthesizing nucleic acid drug conjugate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0128] The nucleic acid aptamer drug complex constructed by the PCR method of embodiment 1

[0129] 1. Nucleic acid aptamer drug complex constructed by PCR method

[0130] The drug used in this example is 5F uracil (drug 1), also known as 5FU (is it 5FdU or 5FU). 5FdU is a base analogue, and 5FdU is connected to an upstream primer by PCR synthesis to obtain an upstream primer with 5FdU connected to its 5' end.

[0131] Construction of nucleic acid aptamer drug complexes (Aptamer-Drug-conjugates, ApDC) by PCR method, the process is as follows figure 1 shown. Wherein, the template is aptamer sgc8 (aptamer 1), which targets PTK7 protein, and its sequence is TTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO.: 3).

[0132] Upstream primer: 5'-FAM-5FdU5FdU5FdU-TTTTTTATTCTAACTGCTG-3'(SEQ ID NO.:1)

[0133] Downstream primer: 5'-Biotin-TCTAACCGTACAGTATTT-3'(SEQ ID NO.:2)

[0134] The PCR system is: 100 μL of 10X buffer, 80 μL of dNTP, 300 μL of upstream and downstream pr...

Embodiment 2

[0148] The bispecific nucleic acid aptamer-drug complex constructed in Example 2

[0149] In a similar manner to the above, two or more nucleic acid aptamer fragments are synthesized, with a few A or T bases between the nucleic acid aptamers to achieve double-specific or even multi-targeting. The drug used in this example is 5F uracil, same as Example 1. Construct nucleic acid aptamer drug complex by PCR method, the process is as follows figure 1 shown. Wherein, the template is the nucleic acid aptamer sgc8-R50, wherein sgc8 targets PTK7 protein and is highly expressed on the surface of leukemia and colon cancer cells, while R50 (aptamer 2) targets lung cancer cells, and its sequence is TTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTTAAAGGGCGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTGTTTC (SEQ ID NO. :5).

[0150] Upstream primer: 5'-FAM-5FdU5FdU5FdU-TTTTTTATTCTAACTGCTG-3'(SEQ ID NO.:1)

[0151] Downstream primer: 5'-Biotin-GAAACAGAAAAACAAC-3'(SEQ ID NO.:4)

[0152] The PCR meth...

Embodiment 3

[0156] The drug-containing nucleic acid aptamer drug complex constructed by the PCR method of embodiment 3

[0157] The drug of this embodiment also includes 5FdC as a base analogue, which can be connected in series with the primers simultaneously with 5FdU, and a subsequent PCR reaction is performed to synthesize ApDC with two drugs.

[0158] Specifically, the synthetic primer 5'-FAM-5FdU5FdU5FdC5FdC-TTTTTTATCTAACTGCTG-3' (SEQ ID NO.: 1), and other downstream primers can be used to connect two drugs in series on the same nucleic acid sequence. The specific implementation method is the same as embodiment column 1.

[0159] The results show that the nucleic acid aptamer drug complex ApDC coupled with two drugs, 5FdC and 5FdU, can selectively target the target well, and has good targeting specificity, less toxic and side effects, and can effectively play the role of the two drugs. effect.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for synthesizing a nucleic acid aptamer drug complex. Specifically, drug molecules are introduced at the 5' tail end of a primer in a quantitative and fixed-point manner through solid-phase synthesis, so that connection from one drug molecule to multiple drug molecules can be realized; an amplification reaction (such as PCR) is performed on a template (such as a nucleic acid aptamer) and a primer with the drug molecules, so that the nucleic acid aptamer drug complex can be synthesized in large quantities; and the primers are shorter and easy to synthesize andseparate, so that the method has the advantages of a high yield, low costs, small difference in batches, and high controllability.

Description

technical field [0001] The invention belongs to the technical field of biopharmaceuticals, in particular to a method for synthesizing nucleic acid drug conjugates. Background technique [0002] There are many methods currently reported for linking nucleic acid aptamers to drug complexes. Among them, covalent linkage is more widely used. [0003] In 2009, Tan’s research group realized the covalent linkage of the drug Dox and the nucleic acid aptamer sgc8, and examined its activity, and found that it can target and specifically kill the target cell CEM of the nucleic acid aptamer sgc8, while No effect on the activity of NB4 cells. [0004] In 2016, the Rossi research group used the nucleic acid aptamer P19 targeting pancreatic cancer to construct nucleic acid aptamer drug complexes through covalent linkage with gemcitabine, 5FdCMP, MMAE, and DM1 respectively, realizing targeted drug delivery and pancreatic cancer targeting treat. [0005] Nucleic acid aptamers and drugs ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10A61K47/54A61K31/513A61P35/00
CPCC12N15/10A61K47/549A61K31/513A61P35/00
Inventor 谭蔚泓王若文孙洋高飞
Owner RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com