Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A rapid detection kit for novel coronavirus antibody based on mixed antigen

A coronavirus, mixed antigen technology, applied in the direction of viruses/phages, viruses, viral peptides, etc., can solve the problem of no specific treatment methods for diseases, and achieve the effects of effective control, high detection sensitivity, and simple operation.

Active Publication Date: 2021-05-18
SICHUAN MACCURA BIOTECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no specific treatment for the disease caused by the new coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rapid detection kit for novel coronavirus antibody based on mixed antigen
  • A rapid detection kit for novel coronavirus antibody based on mixed antigen
  • A rapid detection kit for novel coronavirus antibody based on mixed antigen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] This embodiment provides a novel coronavirus rapid diagnostic kit, specifically prepared through the following steps:

[0038] 1. Expression and purification of COVID-19 nucleocapsid protein

[0039] 1-1. With the nucleotide sequence corresponding to the amino acid sequence of the COVID-19 nucleocapsid protein (i.e. N protein) as a template, design a forward primer whose nucleotide sequence is ATGTCTGATAATGGACCCCA, and a reverse primer whose nucleotide sequence is GGCCTGAGTTGAGTCAGC Direction primers; PCR amplification, double digestion of PCR products and vectors, and cloning into prokaryotic expression vectors, including but not limited to pET28a / pET22b / pET21b / pET32a / pET40 / pGex-6P-1 / pMal-c2x.

[0040]1-2. Transform the recombinant plasmid containing the nucleotide sequence of the COVID-19 nucleocapsid protein into E.coli BL21 or Rossetta strain, spread it on a plate containing ampicillin or kanamycin, and incubate at 37°C After 16 hours, pick a single colony and inoc...

Embodiment 2

[0055] The COVID-19 nucleocapsid protein antigen colloidal gold and the COVID-19 spike protein antigen colloidal gold prepared by the method in Example 1 were clinically verified.

[0056] Take 5 clinically confirmed cases of novel coronavirus pneumonia, 5 normal samples and 2 negative control samples for verification. The verification method is as follows:

[0057] The COVID-19 nucleocapsid protein antigen colloidal gold and spike protein antigen colloidal gold were respectively coated into 96-well plates, and the coating amount of each well was 0.2 μg / well. In addition, the COVID-19 nucleocapsid protein antigen colloidal gold and COVID-19 spike protein antigen colloidal gold were mixed and coated into a 96-well plate, and the COVID-19 nucleocapsid protein antigen colloidal gold and COVID-19 spike protein antigen Each antigen colloid was coated with 0.2 μg / well. Negative control wells were set up when coating.

[0058] Add 100 μL of the above-mentioned different types of sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for rapid detection of novel coronavirus antibody based on mixed antigens, comprising colloidal gold of colloidal gold antigen of nucleocapsid protein antigen of COVID-19 and colloidal gold of antigenic protein of COVID-19 spike protein. The kit is used for diagnosing novel coronavirus pneumonia, and it is easy to operate. It can directly mix the colloidal gold of the colloidal gold of the nucleocapsid protein antigen of COVID-19 and the colloidal gold of the spike protein antigen of the COVID-19 as a whole for detection, or directly mix the COVID-19 nucleocapsid protein antigen colloidal gold and COVID-19 spike protein antigen colloidal gold are mixed for detection, and the detection sensitivity is high, which is conducive to the effective control of the epidemic.

Description

technical field [0001] The invention relates to the technical field of pneumonia detection, in particular to a mixed antigen-based rapid detection kit for novel coronavirus antibodies, which is used for diagnosing novel coronavirus pneumonia. Background technique [0002] The 2019 novel coronavirus (COVID-2019) was named by the World Health Organization on January 12, 2020. Coronaviruses are a large family of viruses known to cause colds as well as more serious illnesses such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). The novel coronavirus is a new strain of coronavirus that has never been found in humans before. [0003] Common signs after a person is infected with a coronavirus include respiratory symptoms, fever, cough, shortness of breath, and dyspnea. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death. Currently, there is no specific treatment for the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569C12N15/50C12N15/70C12N15/85C07K14/165
CPCC07K14/005C07K2319/21C07K2319/30C12N15/70C12N15/85C12N2770/20022G01N33/56983G01N2469/20
Inventor 杨正林钟凌龚波蒋黎石毅黄璐琳龙腾镶刘东泽徐雨干盈盈
Owner SICHUAN MACCURA BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com