Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for gene knockout in Gluconobacter oxidans

A technology for oxidizing glucose and acid bacteria, applied in the field of genetic engineering and bioengineering, can solve problems such as the successful development of CRISPR/Cas gene knockout system, and achieve the effect of easy operation

Active Publication Date: 2022-03-15
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there have been no reports of the successful development of a CRISPR / Cas gene knockout system in Gluconobacter oxydans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for gene knockout in Gluconobacter oxidans
  • A method for gene knockout in Gluconobacter oxidans
  • A method for gene knockout in Gluconobacter oxidans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Shuttle plasmid p2-1-p112-Cas3-p Atse - Construction of crRNA

[0039] Primer pair F1 and R1 designed for linearization of vector p2-1,

[0040] F1:

[0041] ACCGGTTGCCGTTATTACCGGTTCGAGTGCTGG TATGTGTTCCCCGCACACGCGGGGATGAACCGTTTTTTTTGTACTGAGAGTGCACCAT (the underlined part is the homology arm sequence, the same below),

[0042] R1:

[0043] CTGGGATGCCAGCGCGCGAACAACAGTATC AATCTGCTCTGATGCCGCATAG.

[0044] The p2-1 plasmid stored in the laboratory was used as a template, and the primers were used for PCR linear amplification, and the PCR product was purified and recovered to obtain a linearized fragment p2-1 (SEQ ID NO.4).

[0045] Designed to amplify the promoter P 112 sequence of primer pair F2 and R2,

[0046] F2: GATACTGTTGTTCGCGCGC ,

[0047] R2: GGGAAATACTCCTGATTTCGTCCTG .

[0048] Using the genome sequence of Gluconobacter oxydans WSH-003 as a template, F2 and R2 were used to perform PCR amplification on it, and the PCR product was purified an...

Embodiment 2

[0061] Example 2: Construction of upstream and downstream fusion homology arms of sorbose reductase for knocking out Gluconobacter oxidans WSH-003 sorbose reductase

[0062] The primer pair F4 and R4 designed to amplify the sequence of the upstream homologous fragment of sorbose reductase,

[0063] F4: AAGGGAACGAGTCACGGAC,

[0064] R4: ATATTAACAATATAAGTGGATTAACTGCCGATAACCTCATTTTTCT .

[0065] The genome sequence of Gluconobacter oxydans WSH-003 was used as a template, and the primers were used for PCR amplification, and the PCR product was purified and recovered to obtain the upstream homologous fragment of sorbose reductase.

[0066] The primer pair F5 and R5 designed to amplify the downstream homologous fragment sequence of sorbose reductase,

[0067] F5:

[0068] AGAAAAATGAGGTTATCGGCAGTTAATCCACTTATATTGTTAATAT CGTGATTAACTAC,

[0069] R5: TCGGTCACCCCCAGGTC.

[0070] Using the genome sequence of Gluconobacter oxydans WSH-003 as a template, the primer pair F5 and R5 we...

Embodiment 3

[0072] Example 3: Knockout verification of recombinant Gluconobacter oxidans WSH-003 sorbose reductase

[0073] Will sequence the correct p2-1-p112-Cas3-p Atse -crRNA and sorbose reductase were fused with homology arms to co-transform Gluconobacter oxydans WSH-003, and after culturing on a solid sorbitol plate for about 24 hours until visible colonies grew, a single colony was randomly picked and carried out using cross-primers F4 and R5 Colony PCR verification. Colony PCR was performed using Taq PCR Master Mix, and the conditions were as follows: pre-denaturation at 94°C, 3min; amplification stage 25 cycles, 94°C, 30s, 56°C, 30s, 72°C, 2min; final extension at 72°C, 5min.

[0074] If the sorbose reductase gene is knocked out, the size of the fragment obtained by PCR is 1023bp; if the sorbose reductase gene is not knocked out, the size of the fragment obtained by PCR is 1815bp. According to the results of agarose gel electrophoresis, among the 12 single colonies picked at ra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene knockout method in Gluconobacter oxydans, belonging to the technical fields of genetic engineering and bioengineering. In the present invention, the corresponding target gene crRNA and active Cas3 are expressed in Gluconobacter oxydans. By verifying the knockout effect on the target gene in Gluconobacter oxidans, it is shown that this knockout method of the present invention can effectively knock out the target gene in Gluconobacter oxidans, which is different from the existing knockout gene in Gluconobacter oxidans Compared with the method, the operation is simpler, faster and more efficient.

Description

technical field [0001] The invention relates to a gene knockout method in Gluconobacter oxydans, belonging to the technical fields of genetic engineering and bioengineering. Background technique [0002] Gluconobacter oxydans belongs to the acetic acid group, an obligate aerobic Gram-negative microorganism that is well adapted to alcohol-rich habitats such as flowers, fruits, fermented foods and beverages. Due to its well-known incomplete oxidation capacity, this bacterium has been successfully used in the commercial production of vitamin C precursors, dihydroxyacetone, gluconate, miglitol, etc. Gluconobacter oxidans has two spatially separated alcohol and carbohydrate metabolic systems. On the one hand, the periplasmic space containing a large number of membrane-bound dehydrogenases allows rapid incomplete oxidation of different substrates and releases the corresponding products into the fermentation medium. On the other hand, due to the lack of phosphofructokinase and su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/74C12N15/53C12R1/01
CPCC12N15/74C12N9/0006C12Y101/01289
Inventor 周景文秦志杰杨宇彤陈坚曾伟主堵国成
Owner JIANGNAN UNIV