A simulation analysis method of dna polyhedron with special branch number

A technology of simulation analysis and polyhedron, which is applied in the field of simulation analysis of DNA polyhedron, can solve the problems of inability to judge the influence of DNA polyhedron properties, lack of research on the structure of DNA polyhedron, etc., and achieve the effect of low cost

Active Publication Date: 2022-06-03
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the previous experimental synthesis or theoretical simulation, the conventional DNA polyhedron structure was designed, that is, a single strand occupies one face of the DNA polyhedron, such as the four-branched DNA tetrahedron and the eight-branched DNA octahedron. The research on the structure of DNA polyhedron cannot judge the influence of different topological structures on the properties of DNA polyhedron

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A simulation analysis method of dna polyhedron with special branch number
  • A simulation analysis method of dna polyhedron with special branch number
  • A simulation analysis method of dna polyhedron with special branch number

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] (1) First, draw a four-branched DNA tetrahedral chain loop diagram. The number of branches of the DNA tetrahedron is set to 4, the number of crossings on each edge is set to 6, the length of the double helix edge is set to 31nt, and the length of the linker at the vertex is set to 3T. The link diagram of the polyhedral structure of DNA is shown in figure 1 As shown, the whole structure consists of 4 DNA single strands, each strand is 3 tetrahedral side lengths, and the DNA tetrahedron is named 4s.

[0069] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0070] strand 1:

[0071] AAACTACTCCTCGAAGTGATTTGTACCGTCT TTT GATAGGGCGGGACCCGG

[0072] GATAGCATATGGGT TTT TGCCCGGATCGAGACCCCTCAATTCGGGAGG

[0073] strand 2:

[0074] ACCCATATGCTATCCCGGGGTCCCGCCCTATC TTT ATTTGCGTGATCGCATCACTACCAGACGGAC TTT TAAAAGGGGAATCCCTGCCACGTGAATGCGG

[00...

Embodiment 2

[0087] (1) First, draw a bi-branched DNA tetrahedral chain loop diagram. The number of branches of the DNA tetrahedron is set to 2, the number of crossings on each edge is set to 6, the length of the double helix edge is set to 31nt, and the length of the linker at the vertex is set to 3T. The link diagram of the polyhedral structure of DNA is shown in figure 1 As shown, the whole structure consists of 2 DNA single strands, one of which is 3 tetrahedral sides in length, and the other is 9 tetrahedral sides in length, and the DNA tetrahedron is named 2s1.

[0088] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0089] strand 1:

[0090] ATCGTCTATAGTAAGTTTTTCCTAACGCAGG TTT TGTTTTCGCGTTACTTTATAGCGGATTTTCA TTT TTGGATCAAATATGAGTAGGTCACGTATCTA TTT TCGGATCCTAGGCTCAGGATCTGGGTATCCA TTT TAGCACATTCAATCTCCGTTCAGGGGCTCGG TTT TGAAAATCCGCTATAAAGTAACG...

Embodiment 3

[0101] (1) First, draw a bi-branched DNA tetrahedral chain loop diagram. The number of branches of the DNA tetrahedron is set to 2, the number of crossings on each edge is set to 6, the length of the double helix edge is set to 31nt, and the length of the linker at the vertex is set to 3T. The link diagram of the polyhedral structure of DNA is shown in figure 1 As shown, the whole structure is composed of 2 DNA single strands, one of which is 4 tetrahedral sides in length, and the other is 8 tetrahedral sides in length, and the DNA tetrahedron is named 2s2.

[0102] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0103] strand 1:

[0104] GGTCGCTGTCGAAAGGCAGTTTCCTAGCAAT TTT TTCGCACGGTGGAGAGTCCGTCTTAACCGCC TTT TGCCGTCCGACTGGATGTTCAGTTCCTCAAA TTT GCTGTGTAGGTCTGACGCAAAGATCGTACAT TTT ATTGCTAGGAAACTGCCTTTCGACAGCGACC TTT GGGTTTTGCCCTTGTTCAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for simulating and analyzing DNA polyhedrons with a special number of branches. The number of branches of the DNA polyhedron is counted and corresponding chain-link diagrams are drawn. The software NanoEngineer-1 is used to construct an all-atom model of the DNA polyhedron. The software NAMD is used to The DNA polyhedron model is used for molecular dynamics simulation, and the simulation results are analyzed by using the software Gromacs, which can be used to judge the stability of the DNA polyhedron with a special branch number and the influence of different topological structures on the properties of the DNA polyhedron. The invention can be used to judge the stability of DNA polyhedron with special branch number, and provide certain theoretical support for experimental synthesis.

Description

technical field [0001] The invention belongs to the technical field of DNA polyhedron analysis methods, and particularly relates to a method for simulating analysis of DNA polyhedrons with special branch numbers. Background technique [0002] The information disclosed in this Background section is only for enhancement of understanding of the general background of the invention and should not necessarily be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art. [0003] Nucleic acid was discovered by Miescher in 1869. In 1944, Avery proved that DNA is an important genetic material through bacterial transformation experiments. In 1953, Watson and Crick proposed the double-helix structure model of DNA. Since then, nucleic acid-related research has become one of the most active fields in the life sciences. In 1982 seeman proposed the use of DNA as a structural material to assemble ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G16B5/00G16B15/00G16B50/00G16C10/00
CPCG16B5/00G16B15/00G16B50/00G16C10/00
Inventor刘淑雅李佳
OwnerSHANDONG UNIV