Unlock instant, AI-driven research and patent intelligence for your innovation.
A method for precise quantification of Panax notoginseng powder based on droplet digital PCR technology
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A kind of Panax notoginseng powder, droplet technology, applied in the direction of determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effect of strong specificity
Active Publication Date: 2022-05-24
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
The problem of the specific, rapid and accurate quantitative detection of Panax notoginseng powder needs to be solved urgently. At present, there is no relevant research report on the quantitative detection of Panax notoginseng powder by micro-droplet digital PCR
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0023] In this example, the specificity of the designed combination of notoginseng primers and probes is verified by the following experiments.
[0024] (1) Main instruments and reagents
[0025] Instruments: tissue grinder (TissueLyzer II, Qiagen, Germany), nucleic acid and protein analyzer (DU640, Beckman, Germany), PCR instrument, QX200 droplet generator, and reader (Bio-Rad, USA).
[0026] Reagents: 2×ddPCR Supermix for probe (No dUTP), droplet generation oil (Bio-Rad, USA), Biomiga (Biomiga, USA) plant genome extraction kit.
[0027] The primers and probes were provided by Shanghai Sangon Bioengineering Technology Service Co., Ltd. The sequences are as follows:
[0028] The upstream primer is Panax notoginseng -F: AGACCTATCATGATGATTACTCTTCC, the downstream primer is Panax notoginseng- R: GAATAGGAGTATGGAAACAGGTAAGAC; the probe is Panax notoginseng- P: TACCAATCCCAGCGTA, a fluorescent reporter group FAM is connected to the 5' end of the probe, and a fluorescence quench...
Embodiment 2
[0040] In this example, the following experiments are used to establish the linear relationship between the quality of Panax notoginseng powder and DNA concentration, DNA concentration and gene copy number, and then to establish a linear relationship between the quality of Panax notoginseng powder and the number of DNA copies, and finally to measure the quality of Panax notoginseng powder, including the following steps :
[0041] (1) The genomic DNA of Panax notoginseng powder with different mass gradients was extracted by Biomiga kit, and each mass gradient was repeated three times. DNA concentration was determined using a nucleic acid protein analyzer. Take the mass of Panax notoginseng powder M (mg) as the abscissa, and the DNA concentration Y 1 (ng / µL) is the ordinate, and a standard curve is established to obtain the linear relationship between the quality of Panax notoginseng powder and the concentration of DNA. Among them, the whole taproot of Panax notoginseng was p...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a method for quantitatively detecting the ingredients of Panax notoginseng powder by means of droplet digital PCR technology, and the single-copy nucleus gene diacylglycerol kinase 1 gene (diacylglycerol kinase 1 gene, DGK1) designed primer and probe combinations. The method establishes the linear relationship between the mass of Panax notoginseng powder and DNA concentration, and the linear relationship between DNA concentration and gene copy number, and finally constructs the linear relationship between the mass of Panax notoginseng powder and the copy number of nuclear genes, thereby calculating the content of Panax notoginseng powder. Using the micro-droplet digital PCR method of the present invention can realize specific, rapid and accurate quantitative detection of the notoginseng powder, and provide technical support for safeguarding the interests of consumers and market supervision of the notoginseng powder.
Description
technical field [0001] The invention relates to the technical field of food detection, in particular, the invention relates to a detection method for quantifying Panax notoginseng powder by using droplet digital PCR technology, including a single-copy nuclear gene diglyceride applied in the method The combination of primers and probes designed for the target sequence of diacylglycerol kinase 1 gene (DGK1), established the relationship between the quality of Panax notoginseng powder and DNA concentration, DNA concentration and gene copy number, and constructed Panax notoginseng powder with the DNA concentration as the intermediate amount The relationship between mass and nuclear gene copy number was used to determine the content of Panax notoginseng powder. Background technique [0002] Sanqi [ Panax notoginseng (Burk.) F. H. Chen] is a precious Chinese medicinal material, and is listed as a raw material that can be used in health food. Panax notoginseng contains active ing...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More