Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DLEU2 encoded small peptide and application of small peptide in preparation of immunomodulatory drugs

An immunomodulatory drug and drug technology, applied in the field of biomedicine, can solve the problems of shortening, poor stability half-life, etc.

Active Publication Date: 2021-02-09
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As the length of the polypeptide increases, its stability and half-life in vivo are correspondingly reduced or shortened

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DLEU2 encoded small peptide and application of small peptide in preparation of immunomodulatory drugs
  • DLEU2 encoded small peptide and application of small peptide in preparation of immunomodulatory drugs
  • DLEU2 encoded small peptide and application of small peptide in preparation of immunomodulatory drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0089] As an embodiment of the present invention, the functional molecule is a preparation with the function of molecular packaging and loading, including but not limited to liposomes, polymers, dendritic molecules, nano-packaging preparations and the like.

[0090] As an embodiment of the present invention, the functional molecule is a viral vector capable of carrying genetic material, including but not limited to a retroviral vector, a lentiviral vector, or an adenoviral vector.

[0091] The small peptides of the present invention can be connected to functional molecules in a covalent or non-covalent manner. It should be understood that as long as the functions of small peptides and functional molecules can be retained, any connection method can be included in the present invention. Covalent linking usually links two molecules by forming a covalent bond. However, some non-covalent linkage (not forming a covalent bond) such as coupling, adsorption, binding, etc. can also be ...

Embodiment 1

[0104] Example 1, PEP17 sequence analysis and in vitro synthesis

[0105] 1. PEP17 sequence analysis

[0106] The sequence of Dleu2 is as follows (SEQ ID NO: 1):

[0107] AATGTTGACGCAATCTATAAATAGTGGAACAAAAGGACCAACTTCCTCGGAGCTTTGCTGAAACTGCACAAAAAATCGAGCTGGGGGGTTCCCTGGTCCCCG ATGTTGGGGCGGAGAGCGCGGCGCCGAGGGAGGGGGCGGCGCAG ACCGGCCTAG GGGACACCTGGTCGAGCGCAGCCGCCGCTCCGCTCGAGCCCTGCGCTCCAGTGCCCCCACTGGCTGGAGAGCTCGCCCAGACCGGGGGTCTTCCTCCGTCGCTGACAGATTTTAACCATTAGAAGAATACCAGTTCTGGAAAACAACCAAAGTTTCTTTGATTGAATGCCCATGTAATGCATTGGAATATGATAGGCGATTAAGGTTTAACAATGTTAAAATGAAGATATTACTAAAATGGCCCTCTAAATAGCCCAACAATTATTATTTTCTTTGTCCTATGGATTTGGCTTTGAAAGATGTGCTGCTCTTAATAAGCTTTTCATTCTGCCGGCCATACTTTTTCTCCCTACTCTGGACGCCTCTAGATGACTCCAGCTGTGCTCTCCTTCGTAATCTACACACCCTCCTCAACCATACCCTGGACCAGTCATGTCCTCATCTCAGACACGACTTTTCTGGTTTGCACCACAGTGTTTCAATAGCAAGGCTGATGACTTGAGTATGAAAGCTGTGAATCAGGATGCCAGGCAGACAGAATGGATAACATTCTAATTAAATGATCAGCATTAATTCTCTCTCTCGGGCAGAAACCTACGTGTTCCTCTTCCAGAGAGCTGGTGAAGCCAAAGGCATTCTCATAATGATGCGCTACACC...

Embodiment 2

[0111] Example 2, PEP17 promotes Treg cell differentiation

[0112]The PEP17 obtained by the solid-phase polypeptide synthesis method in Example 1 was tested for its effect on Treg cell differentiation.

[0113] 1. Influence on the in vitro induction system of Treg cells

[0114] Obtain mouse spleen cells and isolate mice using immunomagnetic beads CD4+ T cells were cultured in RPMI 1640 medium at 37°C, and anti-CD3 (2.5 μg / ml), anti-CD28 (2 μg / ml), TFG-β (0.3 ng / ml or Other specified concentrations) were cultured for 2-3 days to obtain iTreg cells.

[0115] Treg cells were cultured in RPMI 1640 medium at 37°C and divided into several culture groups. PEP17 was added at concentrations of 0 μM, 5 μM, 10 μM and 20 μM, respectively, and the effect of PEP17 on Treg cell differentiation was observed by flow cytometry.

[0116] Such as figure 2 As shown in A, exogenously synthesized PEP17 was added to mice In the T cell-induced iTreg cell differentiation system, it can be see...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DLEU2 encoded small peptide PEP17 and application of the small peptide PEP17 in preparation of immunomodulatory drugs. The PEP17 has the function of inducing Treg cell (Regulatory T cell) differentiation inside and outside an individual, can reduce Th17 cells in the spleen and central nervous system (CNS) of an experimental allergic encephalomyelitis individual, increasesthe proportion of the Treg cells, and can obviously reduce the incidence of the individual. The PEP17 disclosed by the invention can specifically target the Treg cells, is small in molecular weight and can easily enter the cells to play a role; and the PEP17 disclosed by the invention can be synthesized with a chemical method, is easily prepared in a large scale, has good stability, and is lower in price compared with the existing effective antibody for treating psoriasis. An effective way is provided for treating human immune disorder related diseases such as psoriasis and the like.

Description

technical field [0001] The invention belongs to the field of biomedicine, more specifically, the invention relates to a small peptide encoded by DLEU2 and its application in the preparation of immunomodulatory drugs. Background technique [0002] Regulatory T cells (Treg cells for short) are a subset of T cells that control autoimmune reactivity in the body. Regulatory T cells can be divided into naturally occurring natural regulatory T cells (nTreg cells) and induced adaptive regulatory T cells (iTreg cells). Treg cells often have an immunosuppressive function and secrete various cytokines including IL-10 and TGF-β, which are crucial for maintaining normal immune activities in the body. Treg cells are closely related to the occurrence of autoimmune diseases, and their abnormal expression can lead to autoimmune diseases. [0003] Treg cells are one of the important factors to maintain the immune tolerance of the body. They are produced by the thymus and exported to the per...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/08C12N15/12A61K38/10A61P37/02A61P25/00A61P17/06A61P17/00A61P29/00A61P19/02A61P11/06
CPCC07K7/08A61P37/02A61P25/00A61P17/06A61P17/00A61P29/00A61P19/02A61P11/06A61K38/00
Inventor 王宏林张骏勋
Owner SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com