Method for detecting content of herbicide-resistant transgenic soybean J12 through real-time fluorescent quantitative PCR

A technology for quantitative detection of genetically modified soybeans, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., which can solve the problems of genetically modified soybean J12 qualitative and quantitative, and the lack of genetically modified soybean J12 methods.

Active Publication Date: 2021-02-12
天津市农业科学院
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention overcomes the technical defect that ordinary PCR detection of transgenic soybean J12 can only be qualitative but not quantitative, and provides a method for quantitative detection of transgenic soybean J12
The purpose of the present invention is to solve the problem of the vacancy of the method for quantitatively detecting transgenic soybean J12, which has the advantages of simplicity, high sensitivity, strong specificity and stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting content of herbicide-resistant transgenic soybean J12 through real-time fluorescent quantitative PCR
  • Method for detecting content of herbicide-resistant transgenic soybean J12 through real-time fluorescent quantitative PCR
  • Method for detecting content of herbicide-resistant transgenic soybean J12 through real-time fluorescent quantitative PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] (1) Sample 1: A self-made simulated mixed sample of 5% genetically modified herbicide-tolerant soybean J12. The mixing method was to thoroughly mix 500 ng of genetically modified herbicide-tolerant soybean J12 genomic DNA and 9500 ng of non-transgenic soybean WT genomic DNA.

[0040] (2) Reagents: Premix Ex Taq (Probe qPCR) master mix produced by TaKaRa Company; soybean endogenous Lectin gene and transformant-specific sequence amplification primers synthesized by Shanghai Sangon.

[0041] Transformant-specific sequence primers:

[0042] Forward primer sequence: 5'- GGCTTTACTAAAATATAAATCCTAA -3'

[0043] Reverse primer sequence: 5'- GGCGTTAATTCAGTACATTA -3'

[0044] Probe sequence: FAM-TGACGCTTAGACAACTTAATAACACAT-BHQ1

[0045] endogenous gene Lectin gene sequence:

[0046] Forward primer sequence: 5'-GCCCTCTACTCCACCCCCCA-3'

[0047] Reverse primer sequence: 5'-GCCCATCTGCAAGCCTTTTT-3'

[0048] Probe sequence: FAM-AGCTTCGCCGCTTCCTTCAACTTCAC-BHQ1;

[0049] (3) PCR r...

Embodiment 2

[0064] (1) Sample 2: GM herbicide-tolerant soybean J12 was a self-made simulated mixed sample with 3% ingredients, and the mixing method was 300 ng of genetically modified herbicide-tolerant soybean J12 genomic DNA and 9700 ng of non-transgenic soybean WT genomic DNA were thoroughly mixed.

[0065] (2) Reagents: Premix Ex Taq (Probe qPCR) master mix produced by TaKaRa Company; soybean endogenous Lectin gene and transformant-specific sequence amplification primers synthesized by Shanghai Sangon.

[0066] Transformant-specific sequence primers:

[0067] Forward primer sequence: 5'- GGCTTTACTAAAATATAAATCCTAA -3'

[0068] Reverse primer sequence: 5'- GGCGTTAATTCAGTACATTA -3'

[0069] Probe sequence: FAM-TGACGCTTAGACAACTTAATAACACAT-BHQ1

[0070] endogenous gene Lectin gene sequence:

[0071] Forward primer sequence: 5'-GCCCTCTACTCCACCCCCCA-3'

[0072] Reverse primer sequence: 5'-GCCCATCTGCAAGCCTTTTT-3'

[0073] Probe sequence: FAM-AGCTTCGCCGCTTCCTTCAACTTCAC-BHQ1;

[0074] (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the content of herbicide-resistant transgenic soybean J12 through real-time fluorescent quantitative PCR. According to the method, a specific primer anda probe are designed and synthesized by using a specific sequence of a 3'terminal transformant of herbicide-resistant transgenic soybean J12, a standard curve is made by diluting a standard substancein combination with a soybean endogenous reference gene Lectin, and the percentage composition of the sequence of the transgenosis herbicide-resistant soybean J12 transformant is corrected by using the endogenous reference gene, so that the transgenic herbicide-resistant soybean J12 is obtained. A real-time fluorescent PCR quantitative detection system is constructed for an unknown sample. The real-time fluorescent quantitative PCR detection technology has the advantages of low cost, high sensitivity, strong specificity, relatively simple operation and the like, becomes a main transgenic detection technology recommended by national standards, bulletin of Ministry of Agricultural Department, entry and exit inspection and quarantine industry standards and the like, and has been widely used.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a detection method of a transgenic product, specifically a method for quantitatively detecting transgenic soybean J12 based on real-time fluorescent PCR. The percentage content of herbicide-tolerant soybean J12 transformant sequences, and the construction of a quantitative detection method for transgenic soybean J12. Background technique [0002] Genetically modified crops are developing rapidly in the world, and the planting area of ​​genetically modified soybeans ranks first in the world's planting area of ​​genetically modified crops, accounting for more than 50%. The development of genetically modified soybeans is to cooperate with the use of glyphosate herbicides. Glyphosate-resistant genetically modified crops are currently the largest genetically modified crops in the world. The research and development of genetically modified soybeans can resist glyp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2531/113C12Q2545/114C12Q2563/107
Inventor赵新刘双刘娜李瑞环王成于海涛兰青阔王永
Owner天津市农业科学院