Biliary duct cancer prognosis determination marker, detection primer, kit and application

A technology for detecting primers and cholangiocarcinoma, applied in the field of genetic engineering, can solve the problems of poor effect, unsatisfactory effect, unable to achieve the effect of individualized treatment of patients with cholangiocarcinoma, etc., and achieve the effect of good performance

Inactive Publication Date: 2021-02-12
WENZHOU MEDICAL UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Through the above analysis, the existing problems and defects of the prior art are: the lncRNA gene markers provided by the prior art are poor in judging the prognosis of patients with cholangiocarcinoma after surgery; and the lncRNA gene markers of the prior art select corresponding drugs The effect of adjuvant therapy is not satisfactory, and the effect of individualized treatment for patients with cholangiocarcinoma cannot be achieved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biliary duct cancer prognosis determination marker, detection primer, kit and application
  • Biliary duct cancer prognosis determination marker, detection primer, kit and application
  • Biliary duct cancer prognosis determination marker, detection primer, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] Specific embodiments of the present invention such as Figure 1-6 As shown, in order to make the purpose, technical solution and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0032] Aiming at the problems existing in the prior art, the present invention provides a cholangiocarcinoma prognostic marker, detection primer, kit and application. The present invention will be described in detail below in conjunction with the accompanying drawings.

[0033] The present invention provides a prognostic marker for cholangiocarcinoma. The prognostic marker for cholangiocarcinoma is 5 lncRNAs, and the nucleotide sequence is SEQ ID NO: 1-SEQ ID NO: 5.

[0034] SEQ ID NO: 1:

[0035] FORWARD gaaactctgaagtaaaggccgga

[0036] REVERSE tg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a bile duct cancer prognosis determination marker, a detection primer, a kit and application, the bile ductcancer prognosis determination marker is 5 lncRNAs, and the 5 lncRNAs are respectively HULC, AP000943.4, AC006504.8, AC090114.2 and AL359715.5. A method comprises the following steps: constructing abile duct cancer data set; constructing an LncRNA and gene differential expression profile; establishing an LncRNA related prognosis prediction model; verifying and diagnosing an LncRNA related prognosis prediction model; performing survival prediction that the prognosis LncRNA marker is independent of other clinical pathological characteristic variables; and performing co-expression and functionenrichment analysis: the Spearman correlation coefficient being greater than 0.50 is DPCG related to the LncRNA.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a subject title. Background technique [0002] At present, tumor is a major culprit that seriously threatens human health, and the research on the molecular mechanism of tumor malignant progression has always been the focus and difficulty of the academic circle. It has been reported that tumor cells have cell phenotype characteristics such as promotion of proliferation, invasion and metastasis, continuous angiogenesis, immune tolerance and immune escape during growth. Studies have shown that the growth of tumor cells is a complex multi-gene regulation and multi-step, multi-stage development process, including the inactivation of tumor suppressor genes such as p53 and p21 and the activation of proto-oncogenes such as Blc1 and Myc. So far, the pathogenesis of malignant tumors is still not fully understood and needs to be further explored. [0003] Studies have shown t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11G16H50/50G16B20/00
CPCC12Q1/6886G16H50/50G16B20/00C12Q2600/118C12Q2600/178C12Q2600/158C12Q2600/136
Inventor 王怡陈钢王明勋邓礼明吴莉军
Owner WENZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap