Biliary duct cancer prognosis determination marker, detection primer, kit and application
A technology for detecting primers and cholangiocarcinoma, applied in the field of genetic engineering, can solve the problems of poor effect, unsatisfactory effect, unable to achieve the effect of individualized treatment of patients with cholangiocarcinoma, etc., and achieve the effect of good performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] Specific embodiments of the present invention such as Figure 1-6 As shown, in order to make the purpose, technical solution and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0032] Aiming at the problems existing in the prior art, the present invention provides a cholangiocarcinoma prognostic marker, detection primer, kit and application. The present invention will be described in detail below in conjunction with the accompanying drawings.
[0033] The present invention provides a prognostic marker for cholangiocarcinoma. The prognostic marker for cholangiocarcinoma is 5 lncRNAs, and the nucleotide sequence is SEQ ID NO: 1-SEQ ID NO: 5.
[0034] SEQ ID NO: 1:
[0035] FORWARD gaaactctgaagtaaaggccgga
[0036] REVERSE tg...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com