Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of intellectual disability disease-related atrx gene mutation site and detection kit

A detection kit and a technology for mental retardation, applied in the detection/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of the small number of reports of ID patients and the absence of ATRX gene intron mutations, etc., to achieve Reduce the effect of the procedure

Active Publication Date: 2022-07-15
义乌市妇幼保健院
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Existing studies have found more than 700 genes related to ID, including the ATRX gene, but in general, the number of ID patients with ATRX gene mutations is still relatively small, and mainly exon mutations, there is no ATRX Related reports on gene intron mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of intellectual disability disease-related atrx gene mutation site and detection kit
  • A kind of intellectual disability disease-related atrx gene mutation site and detection kit
  • A kind of intellectual disability disease-related atrx gene mutation site and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The first step is to obtain samples;

[0050] A 3-year-old male patient was collected, with clinical manifestations of motor developmental delay, language developmental delay, severe intellectual disability, and facial abnormality. Genetic metabolism, head MRI, EEG, thyroid function were normal, and no anemia was found. At present, the child is chasing sounds and eyes slowly, laughing when teasing, occasionally vocalizing unconsciously, poor awareness of actively grasping objects with both hands, holding his head up steadily, not turning over on his own initiative, poor weight bearing on his lower extremities, not being able to stand and walk. Grade 4 muscle strength, low muscle tone, and abnormal gastrointestinal function. Suspected diagnosis: cerebral palsy.

[0051] All family members participating in the research of the present invention signed an informed consent form, and obtained the peripheral blood of the patient and related family members.

[0052] The seco...

Embodiment 2

[0076] This embodiment provides a DNA detection kit and an mRNA detection kit for auxiliary diagnosis of intellectual disability diseases.

[0077] Wherein, the DNA detection kit includes the amplification primer of the ATRX gene mutation site in Example 1, the amplification primer of the mutation site includes an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is such as SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3, which was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0078] The above DNA detection kit also includes PCR reagents, PCR product purification reagents, and Sanger sequencing reagents.

[0079] The PCR reagent is KAPA2G Robμst HotStart PCR Kit, including: 5X KAPA2G Buffer A / 5X KAPA2G Buffer B / 5X KAPA2G GC Buffer, 5X KAPA Enhancer 1, 10mM KAPAdNTP Mix, 5U / μL KAPA2G Robust HotStar DNA Polymerase, PCR-grade water. The working concentrations of each component in the...

Embodiment 3

[0170] This example provides an mRNA, which is obtained by transcribing the mutant ATRX gene in Example 1, and the mRNA has the deletions of Exon7, Exon9 and Exon24 as mentioned in Example 2 above;

[0171] Among them, Exon7 deletion (AGA);

[0172] Exon9 missing

[0173] (ATTAAATCAAAAACTACAGCTAAAGTAACAAAAGAATTATATGTTAAACTCACTCCTGTTTCCCTTTCTAATTCCCCAATTAAAGGT);

[0174] Exon24 is missing the entire exon.

[0175] The experiment verified that the mutation of the intron of the ATRX gene produces abnormal mRNA, clarified the pathogenicity of the mutation, and revealed the pathogenesis of intellectual disability caused by the mutation.

[0176] Next, the nucleotide sequences of the amplification primers involved in the above Examples 1 to 3 and the lengths of the corresponding amplification products obtained are shown in the following table:

[0177]

[0178]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a mutation site of an ATRX gene related to intellectual disability, the mutation site is located in intron 24 of the ATRX gene, and the mutation information of the mutation site is: c.5786+4 (IVS24) A>G (NM_000489.6); at the same time, the present invention also provides a DNA detection kit and an mRNA detection kit for auxiliary diagnosis of intellectual disability, respectively, the DNA detection kit is used for the above-mentioned The mutation site is detected, and the mRNA detection kit is used to detect the mRNA transcribed from the mutated ATRX gene. The mutation site described in the first aspect and the result obtained from the transcription of the ATRX gene can be directly detected by first-generation sequencing. The mRNA of this mutation clarifies the pathogenicity of this mutation, reveals the pathogenesis of intellectual disability caused by this mutation, and can also be used for accurate diagnosis of ATRX gene-related intellectual disability diseases.

Description

technical field [0001] The present invention relates to the field of biotechnology, and more particularly, the present invention relates to a mutation site of an ATRX gene related to intellectual disability and a detection kit. Background technique [0002] Intellectual disability (ID) refers to patients with obvious deficits in cognitive function and social adaptability before the age of 18, manifested as an IQ value of less than 70 on an intelligence test. The clinical phenotypes of ID patients are diverse, ranging from intellectual disability to congenital malformations or other neurological abnormalities such as autism spectrum disorder (ASD) and epilepsy. Globally, the incidence of ID is about 1 to 3%. According to related studies, the lifetime medical cost of a patient with intellectual disability can reach 1 million US dollars. ID is mainly divided into genetic factors and non-genetic factors, and genetic factors account for about 2 / 3 of the causes of ID. It can be ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/158
Inventor 吴轲丛研
Owner 义乌市妇幼保健院