A kind of intellectual disability disease-related atrx gene mutation site and detection kit
A detection kit and a technology for mental retardation, applied in the detection/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of the small number of reports of ID patients and the absence of ATRX gene intron mutations, etc., to achieve Reduce the effect of the procedure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The first step is to obtain samples;
[0050] A 3-year-old male patient was collected, with clinical manifestations of motor developmental delay, language developmental delay, severe intellectual disability, and facial abnormality. Genetic metabolism, head MRI, EEG, thyroid function were normal, and no anemia was found. At present, the child is chasing sounds and eyes slowly, laughing when teasing, occasionally vocalizing unconsciously, poor awareness of actively grasping objects with both hands, holding his head up steadily, not turning over on his own initiative, poor weight bearing on his lower extremities, not being able to stand and walk. Grade 4 muscle strength, low muscle tone, and abnormal gastrointestinal function. Suspected diagnosis: cerebral palsy.
[0051] All family members participating in the research of the present invention signed an informed consent form, and obtained the peripheral blood of the patient and related family members.
[0052] The seco...
Embodiment 2
[0076] This embodiment provides a DNA detection kit and an mRNA detection kit for auxiliary diagnosis of intellectual disability diseases.
[0077] Wherein, the DNA detection kit includes the amplification primer of the ATRX gene mutation site in Example 1, the amplification primer of the mutation site includes an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is such as SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3, which was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0078] The above DNA detection kit also includes PCR reagents, PCR product purification reagents, and Sanger sequencing reagents.
[0079] The PCR reagent is KAPA2G Robμst HotStart PCR Kit, including: 5X KAPA2G Buffer A / 5X KAPA2G Buffer B / 5X KAPA2G GC Buffer, 5X KAPA Enhancer 1, 10mM KAPAdNTP Mix, 5U / μL KAPA2G Robust HotStar DNA Polymerase, PCR-grade water. The working concentrations of each component in the...
Embodiment 3
[0170] This example provides an mRNA, which is obtained by transcribing the mutant ATRX gene in Example 1, and the mRNA has the deletions of Exon7, Exon9 and Exon24 as mentioned in Example 2 above;
[0171] Among them, Exon7 deletion (AGA);
[0172] Exon9 missing
[0173] (ATTAAATCAAAAACTACAGCTAAAGTAACAAAAGAATTATATGTTAAACTCACTCCTGTTTCCCTTTCTAATTCCCCAATTAAAGGT);
[0174] Exon24 is missing the entire exon.
[0175] The experiment verified that the mutation of the intron of the ATRX gene produces abnormal mRNA, clarified the pathogenicity of the mutation, and revealed the pathogenesis of intellectual disability caused by the mutation.
[0176] Next, the nucleotide sequences of the amplification primers involved in the above Examples 1 to 3 and the lengths of the corresponding amplification products obtained are shown in the following table:
[0177]
[0178]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


