Rice grain shape gene SRN1, protein and application thereof

A gene and rice technology, applied in the field of rice grain shape gene SRN1, protein, to achieve the effect of increasing rice yield

Active Publication Date: 2021-08-10
CHINA NAT RICE RES INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these yield-related genes have been cloned one after another and provide valuable genetic resources for high-yielding rice breeding, due to complex traits and technical limitations of multi-gene manipulation, only a small number of yield-related genes have been successfully used in molecular design breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice grain shape gene SRN1, protein and application thereof
  • Rice grain shape gene SRN1, protein and application thereof
  • Rice grain shape gene SRN1, protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Construction of Rice SRN1 Gene Overexpression Vector

[0027] According to the SRN1 gene sequence published on Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ) (SRN1 gDNA: CATCACAAAACACATAAAACTATATCATCATCT TCCATAGCTGTACACATCCTATATTTTCATTC ATGGCGATGACACCGCA GCTAGCATTTTCTCGCA TGCCTCCAGGGTTTCGGTTCCAGCCGACGGACGAGCAGCTTGTCGTCGACTACTTGCAGAGGCGT ACCGCTGCGCAGCCATGCGTTACTCCCGACATCACCGATATCGACGTTTACAACGTCGACCCGTG GCAGCTTCCAGGTGCTATATATATGCGCACTTTAATTTGCATGAGCCTCACTACATACGGTGCTCT CTACTGGTAGTAGAAATCAATCTAAACCGTTAATCTTATTTGACCGAATGGTTCAGAGATCTATTT ATATTATGGTAGTAAAATCGTGGATGGGTGTTATCGTCAGAAAAAAAAATAGGGGTGAAGGGTA TAGTCGTCATTTAGCAGTGGCTAAACTCTTTTTTCTCCTTTTTTGGCTTTTTCGATGAAATATGAGC GATGCCAGCGCAATAGATGATCATAGATCAATTTAGCTGAGAAAAAACATAAATGACAAAATAA TTTCTAATCATTGTATTAGTAAATTACTAATTTACCTTAATAATACTGATACTAGTAGTATAATAC TACCAGTAGAGAGCACCAGAGCGTCGATTTGCATACGAGGCAGGGCGGAGGCAGGCCTAGGACA GGTAGGGCTTAAGCCCTAGGCTTGTTGCCTCCAAAATCATGGTTAAACTCTCTTAAATCATCATTT AAATTTGGGAAAAGAAATGAATAACTAAT...

Embodiment 2

[0029] Construction of OxSRN1 Overexpression Plants

[0030] The transformation process of Agrobacterium is as follows: add the ligation product to the chemically competent cells of Agrobacterium on ice, flick the tube wall to mix, and ice bath for 5 minutes; take liquid nitrogen for quick freezing for 5 minutes, and immediately place it on ice for 3~ 5mins; add 800μL LB culture solution (without adding antibiotics), incubate on a shaker at 120rpm at 28°C for 3-4hrs; centrifuge at 8000rpm for 1min, discard about 500μL of the supernatant, resuspend the remaining bacteria, and spread on the corresponding resistant LB solid plate , Inverted in a 28°C incubator for 30-36hrs. After the growth of single bacteria, positive engineering bacteria were screened and identified.

[0031] Finally, the calli of Nipponbare, Zhongshui 01 and Nanjing 46 were transformed by Agrobacterium-mediated transformation, and T0 generation transgenic plants were obtained (see figure 2 , 3 ). The rice...

Embodiment 3

[0038] Identification of Transgenic Lines Overexpressing SRN1 Gene in Rice

[0039] Leaf RNA extraction:

[0040] Take a fresh water leaf sample of the SRN1 gene overexpression transgenic line in an RNase-free centrifuge tube and immediately put it into liquid nitrogen, and grind the sample with a grinding rod to form a powder. Add 1mL Trizol each, shake and mix well, and let stand at room temperature for 10mins. Then add 200 μL of chloroform and mix well, centrifuge at 12,000 rpm at 4°C for 10 mins, pipette the supernatant into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol to each, and invert to mix well. Centrifuge at 12000rpm at 4°C for 10mins, discard the supernatant, and use 75% ethanol solution (using DEPC·H 2 (O) Wash the precipitate, and treat the sample with RNase-free DNase I (Takara) at 37°C for 30mins. After repeated precipitation with 70% ethanol, dry at room temperature, and use DEPC·H 2 O dissolves RNA. Store at -80°C for later...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice grain shape gene SRN1, a protein and application thereof, and relates to the technical field of plant genetic engineering. The invention provides a rice grain shape and grain weight gene SRN1, a protein coded by the rice grain shape and grain weight gene SRN1 and application of the rice grain shape and grain weight gene SRN1 to regulation and control of plant grain shape and grain weight. The invention also discloses a plasmid containing the gene, a plant expression vector, a host cell and application of the gene in regulation and control of the rice grain shape. According to the invention, the genetic mechanism of rice grain shape and grain weight is further clarified through function interpretation of the SNR1 gene, and a foundation is laid for increasing rice yield.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a rice grain shape gene SRN1, protein and application thereof. Background technique [0002] Although my country's rice breeding has gone through the green revolution and heterosis, the two major innovations have been used to increase the rice yield. However, with the arable land area and fresh water resources becoming increasingly tense and the population continuing to increase, my country's food demand is facing the problem of how to continue to grow. [0003] Genetic design breeding is the main way to solve this problem. The study of rice functional genomics, especially the study of related genes that regulate important yield traits, will provide genetic resources for rice molecular breeding. At the same time, as a monocot model plant, the relevant research results in rice will also provide reference for other grass crops, such as wheat and corn. [0004] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00A01H5/10A01H6/46
CPCC07K14/415C12N15/8261C12N15/8205
Inventor张健李志永童晓红王以锋应杰政
OwnerCHINA NAT RICE RES INST