Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a specific primer set for fox retrovirus detection and pcr detection kit

A technology of retrovirus and detection kit, applied in the direction of microbe-based methods, microbes, recombinant DNA technology, etc., can solve the problems of obvious litter characteristics, small fox fur, and difficult disease prevention and control, and achieve sample processing and The detection process is simple, the sensitivity and specificity are improved, and the effect of low level requirement

Active Publication Date: 2022-08-02
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, fox retroviruses have caused fox dysplasia, kidney enlargement, and growth retardation in fox breeding. The disease is not obviously contagious, but the litter characteristics are obvious. Finally, it has a serious impact on the growth of foxes. The most intuitive impact is that the fox fur is small, the fur is rough and scarce, and the fox dies, resulting in a reduction or extinction of fox fur production.
[0003] At present, there are no specific treatment and preventive measures for the above-mentioned diseases of foxes, making it difficult to prevent and control the disease. Under the current situation, in order to reduce breeding losses, timely detection of diseased foxes and timely stop loss are the most effective ways to reduce losses Therefore, how to accurately detect whether the fox is sick is of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a specific primer set for fox retrovirus detection and pcr detection kit
  • Application of a specific primer set for fox retrovirus detection and pcr detection kit
  • Application of a specific primer set for fox retrovirus detection and pcr detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Establishment of PCR method for fox retrovirus detection

[0036] In this method, the fox retrovirus gene sequence is screened and analyzed, and the gag gene (NC_007815.2) is selected as the target gene, which is derived from the heterotropic mouse leukemia virus-related virus (XMRV). The gene sequence is shown in SEQ ID No.3, as follows:

[0037] ATGGGACAGACCGTAACCACTCCCTTGAGTCTGACCCTTGAACACTGGGGAGACGTCCAGCGCATTGCGTCCAACCAGTCCGTGGACGTCAAGAAGAGACGCTGGGTCACCTTCTGCTCTGCCGAGTGGCCAACTTTCGATGTGGGGTGGCCGCAAGATGGTACTTTTAATTTGGACATTATTTTACAGGTTAAATCTAAGGTGTTCTCTCCCGGTCCCCACGGACACCCGGATCAGGTCCCATACATTGTCACCTGGGAGGCTATTGCCTATGAACCCCCTCCGTGGGTCAAGCCTTTTGTCTCTCCCAAACTCCCCCTCTCTCCAACCGCTCCCATCCTCCCATCCGGTCCTTTGACCCAACCTCCGCCCCGATCTGCCCTTTACCCTGCTCTTACCCCCTCTATGAAACCCAGACCTTCTAAACCTCAGGTTCTCTCCGATAACGACGGACCTCTCATTGACCTTCTCACAGAAGACCCTCCGCCGTACGGAGAACAGGGACCGTCCTCCTCTGACGGGGATGGCGACAGAGAAGAGGCCACCTCCACTTCTGAGATTCCTGCCCCCTCTCCCATGGTGTCTCGCCTGCGGGGCAAAAGAGACCCCCCCGCGGCAGATTCCA...

Embodiment 2

[0054] Embodiment 2 is used for fox retrovirus PCR detection kit

[0055] The PCR detection kit includes nucleic acid release agent, negative control, positive control, enzyme mixture and primers.

[0056] Wherein, the primers were specific primers provided in Example 1; the nucleic acid releasing agent was 200 mM Tris-HCl (pH 8.0), 500 mM NaCl, 5 mM EDTA, 1% sodium dodecyl sulfonate (SDS, W / V), 2% lithium dodecyl sulfate (LLS, W / V) and 1% betaine (W / V); the enzyme mixture is 0.1U / μL Taq DNA Polymerase (DNA polymerase), 2 ×PCR reaction buffer, 3mM MgCl 2 , 0.4mM dNTPs; the positive control is pMD18T-GAG plasmid, and the negative control is nuclease-free water.

[0057] According to the sequence of the gag gene, the full-length primers SEQ ID No. 4-F and SEQ ID No. 4-R were designed to amplify the gag gene. The gag gene was obtained by PCR and ligated into the pMD18T vector to construct the pMD18T-GAG plasmid. The correct plasmid identified by sequencing and double restrict...

Embodiment 3

[0059] Example 3 Sample Preparation

[0060] The kidney samples, lung samples, brain samples, liver samples and spleen samples of the sick fox were prepared separately. The preparation methods of the samples are as follows:

[0061] The kidney, lung, brain, liver, and spleen of the sick fox were taken, ground with a grinder until pulverized, freeze-thawed three times, centrifuged at 8000 rpm for 5 min, and the precipitate was removed, and the supernatant was taken for use.

[0062] Further, the kidney samples, lung samples, brain samples, liver samples and spleen samples are marked as A, B, C, D, and E, respectively, for use.

[0063] Among them, the fox retrovirus strain obtained from the kidney tissue of the diseased fox was named PreXMRV-20, and the classification was named gamma retrovirus; the fox retrovirus strain was deposited in China Microbial Bacteria on June 23, 2021 The General Microbiology Center of the Species Collection Management Committee, the deposit number ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific primer set for fox retrovirus detection and the application of a PCR detection kit. The primer set includes two pairs of primers, wherein: the first pair of primers: upstream primer 1 such as SEQ ID No.1-F As shown, the downstream primer 1 is shown in SEQ ID No.1-R; the second pair of primers: the upstream primer 2 is shown in SEQ ID No.2-F; the downstream primer 2 is shown in SEQ ID No.2-R. The application of the specific primer set in PCR detection is specifically the application of the specific primer set in a PCR detection kit. The use of the specific primer set can improve the sensitivity and specificity of PCR, thereby improving the accuracy of fox retrovirus detection. The specific primers are applied to the PCR detection kit, which can realize the detection of fox retrovirus. Fast, accurate detection with simple sample handling and detection.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to the application of a specific primer set for fox retrovirus detection and a PCR kit. Background technique [0002] The main goal of fox breeding is to produce fox skins, and the quality of fox skins directly affects the economic benefits of raising foxes. In recent years, fox retroviruses have appeared in fox breeding, causing fox dysplasia, kidney enlargement, and developmental stagnation. The disease is not contagious, but the litter features are remarkable. When foxes have symptoms of the disease. Afterwards, it has a serious impact on the growth of foxes. The most intuitive impact is that the fox fur is small, rough, scarce, and the fox dies, resulting in the reduction or extinction of fox fur production. [0003] At present, there is no specific treatment and preventive measures for the above-mentioned diseases of foxes, which makes it difficult to prevent and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/702C12Q1/686C12Q2527/125C12Q2545/113
Inventor 王玉茂韩强于新友郭广君付石军庄金秋王建军沈志强
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY