Application of a specific primer set for fox retrovirus detection and pcr detection kit
A technology of retrovirus and detection kit, applied in the direction of microbe-based methods, microbes, recombinant DNA technology, etc., can solve the problems of obvious litter characteristics, small fox fur, and difficult disease prevention and control, and achieve sample processing and The detection process is simple, the sensitivity and specificity are improved, and the effect of low level requirement
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Establishment of PCR method for fox retrovirus detection
[0036] In this method, the fox retrovirus gene sequence is screened and analyzed, and the gag gene (NC_007815.2) is selected as the target gene, which is derived from the heterotropic mouse leukemia virus-related virus (XMRV). The gene sequence is shown in SEQ ID No.3, as follows:
[0037] ATGGGACAGACCGTAACCACTCCCTTGAGTCTGACCCTTGAACACTGGGGAGACGTCCAGCGCATTGCGTCCAACCAGTCCGTGGACGTCAAGAAGAGACGCTGGGTCACCTTCTGCTCTGCCGAGTGGCCAACTTTCGATGTGGGGTGGCCGCAAGATGGTACTTTTAATTTGGACATTATTTTACAGGTTAAATCTAAGGTGTTCTCTCCCGGTCCCCACGGACACCCGGATCAGGTCCCATACATTGTCACCTGGGAGGCTATTGCCTATGAACCCCCTCCGTGGGTCAAGCCTTTTGTCTCTCCCAAACTCCCCCTCTCTCCAACCGCTCCCATCCTCCCATCCGGTCCTTTGACCCAACCTCCGCCCCGATCTGCCCTTTACCCTGCTCTTACCCCCTCTATGAAACCCAGACCTTCTAAACCTCAGGTTCTCTCCGATAACGACGGACCTCTCATTGACCTTCTCACAGAAGACCCTCCGCCGTACGGAGAACAGGGACCGTCCTCCTCTGACGGGGATGGCGACAGAGAAGAGGCCACCTCCACTTCTGAGATTCCTGCCCCCTCTCCCATGGTGTCTCGCCTGCGGGGCAAAAGAGACCCCCCCGCGGCAGATTCCA...
Embodiment 2
[0054] Embodiment 2 is used for fox retrovirus PCR detection kit
[0055] The PCR detection kit includes nucleic acid release agent, negative control, positive control, enzyme mixture and primers.
[0056] Wherein, the primers were specific primers provided in Example 1; the nucleic acid releasing agent was 200 mM Tris-HCl (pH 8.0), 500 mM NaCl, 5 mM EDTA, 1% sodium dodecyl sulfonate (SDS, W / V), 2% lithium dodecyl sulfate (LLS, W / V) and 1% betaine (W / V); the enzyme mixture is 0.1U / μL Taq DNA Polymerase (DNA polymerase), 2 ×PCR reaction buffer, 3mM MgCl 2 , 0.4mM dNTPs; the positive control is pMD18T-GAG plasmid, and the negative control is nuclease-free water.
[0057] According to the sequence of the gag gene, the full-length primers SEQ ID No. 4-F and SEQ ID No. 4-R were designed to amplify the gag gene. The gag gene was obtained by PCR and ligated into the pMD18T vector to construct the pMD18T-GAG plasmid. The correct plasmid identified by sequencing and double restrict...
Embodiment 3
[0059] Example 3 Sample Preparation
[0060] The kidney samples, lung samples, brain samples, liver samples and spleen samples of the sick fox were prepared separately. The preparation methods of the samples are as follows:
[0061] The kidney, lung, brain, liver, and spleen of the sick fox were taken, ground with a grinder until pulverized, freeze-thawed three times, centrifuged at 8000 rpm for 5 min, and the precipitate was removed, and the supernatant was taken for use.
[0062] Further, the kidney samples, lung samples, brain samples, liver samples and spleen samples are marked as A, B, C, D, and E, respectively, for use.
[0063] Among them, the fox retrovirus strain obtained from the kidney tissue of the diseased fox was named PreXMRV-20, and the classification was named gamma retrovirus; the fox retrovirus strain was deposited in China Microbial Bacteria on June 23, 2021 The General Microbiology Center of the Species Collection Management Committee, the deposit number ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More