Unlock instant, AI-driven research and patent intelligence for your innovation.

False gene data bank construction method of rice genome

A technology of whole genome and construction method, applied in the field of rice whole genome pseudogene database construction

Inactive Publication Date: 2006-02-15
ZHEJIANG UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the pseudogene analysis of the rice genome and the publication of the pseudogene data of the whole rice genome have not been completed at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] The present invention is further described by examples below.

[0027] (1) Construct a local database of known rice genome sequences in a computer system:

[0028] The pseudogene data in this example is mainly to search and collect DNA sequences that may encode known proteins using homology alignment (BLAST and other programs) in the whole genome sequence of rice. The indica and japonica rice data came from the whole genome sequence of indica and japonica rice sequenced by the Beijing Institute of Genomics, Chinese Academy of Sciences, and all the protein data came from the official FTP (cdna01.dna.affrc.go.jp) of the International Rice Genome Project (IRGSP).

[0029] The format of the genome sequence database (GenomeSequence.fasta) of indica and japonica rice is:

[0030] >Chr01

[0031] GCGCGGGGAAGGGCCGATGGGCCGCGGGGGAGAGGAGAGAGAGGGAGGGGACTGGGCCGAGCCG

[0032] GCCCAAGAAGGGAAGGGGGTGGAAAGAA

[0033] ...

[0034] >Chr12

[0035] GCGCGGGGAAGGGCCGATGGGCCGCGGGGGAGAGGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing pseudogene database of rice global genome, which comprises constructing a local data base of known rice global genome sequences in a computer system, proceeding search and comparison to the data base through BLAST program, obtaining standard BLAST format comparison result, using the SeqIO module in the Bioperl to analyze the comparison result, obtaining the information file recording characteristic value data for the pseudogenes and genes, removing redundant pseudogenes and genes data, screening and sorting pseudogenes, building data base of the pseudogenes by using characteristic value corresponding to pseudogenes as the data item marker.

Description

technical field [0001] The invention relates to a method for processing gene sequence data, more specifically, the invention relates to a method for constructing a rice genome pseudogene database. Background technique [0002] Pseudogenes are DNA sequences that lose function in the genome, in other words, multiple copies of functional genes that do not have the ability to encode, or sequences that are similar to functional genes. Pseudogenes are well preserved molecular records of ancestral genes in genomes millions of years ago and are regarded as "gene fossils". Therefore, pseudogenes are important resources in evolution and comparative genomics. The application of pseudogene and gene comparison system can provide new insights for studying species kinship and evolutionary distance, analyzing the evolution trend of pseudogene itself, and exploring the causes of DNA mutations. [0003] The Gerstein laboratory of Yale University in the United States has provided relevant pap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/00C12N15/29
Inventor 薛庆中黄志华张忠华
Owner ZHEJIANG UNIV