False gene data bank construction method of rice genome
A technology of whole genome and construction method, applied in the field of rice whole genome pseudogene database construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0026] The present invention is further described by examples below.
[0027] (1) Construct a local database of known rice genome sequences in a computer system:
[0028] The pseudogene data in this example is mainly to search and collect DNA sequences that may encode known proteins using homology alignment (BLAST and other programs) in the whole genome sequence of rice. The indica and japonica rice data came from the whole genome sequence of indica and japonica rice sequenced by the Beijing Institute of Genomics, Chinese Academy of Sciences, and all the protein data came from the official FTP (cdna01.dna.affrc.go.jp) of the International Rice Genome Project (IRGSP).
[0029] The format of the genome sequence database (GenomeSequence.fasta) of indica and japonica rice is:
[0030] >Chr01
[0031] GCGCGGGGAAGGGCCGATGGGCCGCGGGGGAGAGGAGAGAGAGGGAGGGGACTGGGCCGAGCCG
[0032] GCCCAAGAAGGGAAGGGGGTGGAAAGAA
[0033] ...
[0034] >Chr12
[0035] GCGCGGGGAAGGGCCGATGGGCCGCGGGGGAGAGGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 