Chemotactic cytokine III

a cytokine and cytokine technology, applied in the field of cytokine iii, can solve the problem that no precise role can be attached to the members of the branch, and achieve the effect of enhancing or potentiating the effect of cciii

Inactive Publication Date: 2006-04-06
HUMAN GENOME SCI INC
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0025] In accordance with another aspect of the present invention, there are provided CCIII agonists. Among preferred agonists are molecules that mimic CCIII, that bind to CCIII-binding molecules or receptor molecules, and that elicit or augment CCIII-induced responses. Also among preferred agonists are molecules that interact with CCIII or CCIII polypeptides, or with other modulators of CCIII activities, and thereby potentiate or augment an effect of CCIII or more than one effect of CCIII.
[0026] In accordance with yet another aspect of the present invention, there are provided CCIII antagonists. Among preferred antagonists are those which

Problems solved by technology

However, members of one branch may exert an effect on cells which are normally responsive to the other branch of chemokines and, therefore, no precise role can be attached to the members of the branches.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chemotactic cytokine III
  • Chemotactic cytokine III
  • Chemotactic cytokine III

Examples

Experimental program
Comparison scheme
Effect test

example 1

Expression and Purification of Human CCIII Using Bacteria

[0229] The DNA sequence encoding human CCIII in the deposited polynucleotide was amplified using PCR oligonucleotide primers specific to the amino acid carboxyl terminal sequence of the human CCIII protein and to vector sequences 3′ to the gene. Additional nucleotides containing restriction sites to facilitate cloning were added to the 5′ and 3′ sequences respectively.

[0230] The 5′ oligonucleotide primer had the sequence 5′CGCCCATGGTGGCCGCCGCGCAGG 3′ (SEQ ID NO:3) containing a Nco I restriction site, which encodes a start AUG, followed by 16 nucleotides of the human CCIII coding sequence set out in FIG. 1.

[0231] The 3′ primer had the sequence 5′CGCAAGCTTGCAGAGCTCAATTTA 3′ (SEQ ID NO:4) containing the underlined BamHI restriction site followed by 15 nucleotides complementary to CCIII non-coding sequence set out in FIG. 1, including the stop codon.

[0232] The restrictions sites were convenient to restriction enzyme sites in t...

example 2

Cloning and Expression of Human CCIII in a Baculovirus Expression System

[0235] The cDNA sequence encoding the full length human CCIII protein, in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5′ and 3′ sequences of the gene:

[0236] The 5′ primer has the sequence 5′CGCGGATCCGCCATCATGGCGCCCGGAGTG 3′ (SEQ ID NO:5) containing the underlined BamHI restriction enzyme site followed by Kozak sequence and 15 bases of the sequence of CCIII of FIG. 1. Inserted into an expression vector, as described below, the 5′ end of the amplified fragment encoding human CCIII provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the vector portion of the construct.

[0237] The 3′ primer has the sequence 5′CGCGGTACCGCAGAGCTCAATTTA 3′ (SEQ ID NO:6) containing the underlined Asp718 restriction followed by nucleotides complemen...

example 3

Expression of CCIII in COS Cells

[0247] The expression plasmid, CCIII HA, is made by cloning a cDNA encoding CCIII into the expression vector pcDNAI / Amp (which can be obtained from Invitrogen, Inc.).

[0248] The expression vector pcDNAI / amp contains: (1) an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.

[0249] A DNA fragment encoding the entire CCIII precursor and a HA tag fused in frame to its 3′ end is cloned into the polylinker region of the vector so that recombinant protein expression i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Login to View More

Abstract

Human chemotactic cytokine III polypeptides and DNA (RNA) encoding such chemotactic cytokines and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemotactic cytokines for the treatment of leukemia, tumors, chronic infections, auto-immune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemotactic cytokines and their use as a therapeutic to treat rheumatoid arthritis, auto-immune and chronic and acute inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever, cerebral ischemia, glomerulonephritis, HTLV-1 related diseases and bone marrow failure are also disclosed. Also disclosed are diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences and altered concentrations of the polypeptides. Also disclosed are diagnostic assays for detecting mutations in the polynucleotides encoding chemotactic cytokine III and for detecting altered levels of the polypeptide in a host.

Description

CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application is a continuation of and claims priority under 35 U.S.C. § 120 to U.S. application Ser. No. 09 / 986,191, filed Nov. 7, 2001, which is a continuation of and claims priority under 35 U.S.C. § 120 to U.S. application Ser. No. 09 / 329,331, filed Jun. 10, 1999, which is a divisional of and claims priority under 35 U.S.C. § 120 to U.S. application Ser. No. 08 / 812,003, filed Mar. 5, 1997 (now U.S. Pat. No. 5,952,197, issued Sep. 14, 1999), which claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 60 / 013,609, filed Mar. 5, 1996. All of the aforementioned applications are herein incorporated by reference in their entireties.FIELD OF THE INVENTION [0002] This invention relates, in part, to newly identified polynucleotides and polypeptides; variants and derivatives of the polynucleotides and polypeptides; processes for making the polynucleotides and the polypeptides, and their variants and derivatives; agonis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/02C07H21/04C07K14/52A61K38/00C12N15/19
CPCA61K38/00C07K14/52C07K14/521Y02A50/30
InventorNI, JIANGENTZ, REINERYU, GUO-LIANGSU, JEFFREYDILLON, PATRICK
OwnerHUMAN GENOME SCI INC