Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid detecting method for H5 hypotype fowl influenza virus and kit thereof

An avian influenza virus and detection method technology, applied in the field of viruses, can solve the problems of low sensitivity, slow identification, poor specificity, etc., and achieve the effect of good specificity and omitting cumbersome steps.

Active Publication Date: 2007-08-15
ZHANGZHOU BOXIN BIOLOGICAL TECH CO LTD
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problems of slow identification, low sensitivity, poor specificity and difficulty in adapting to rapid diagnosis during epidemics in the existing methods for the detection of H5 subtypes of avian influenza virus, and to provide a method that is easy to operate, high in experimental reliability, and can be carried out. A nucleic acid detection method for H5 subtype avian influenza virus with real-time detection, high sensitivity, good specificity and short cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid detecting method for H5 hypotype fowl influenza virus and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] 1) Seek the unique conserved sequence of H5 subtype avian influenza virus as the target gene to be tested. The length of the conserved sequence is 100-250bp, and the conserved sequence is:

[0043] catt ccacaacata caccctctca ccatcgggga gtgccccaaa tatgtgaaat caaacagattagtccttgcg actggactca gaaatacccc tcaaagagag agaagaagaaaaaagagagg actatttggagctatagcag gttttataga gggaggatgg cagggaatgg tagatggttg.

[0044] 2) Design and synthesize a pair of H5 subtype avian influenza virus-specific primers, the primer length is between 18-30bp, the annealing temperature is 50-60°C, and the sequence of a pair of H5 subtype avian influenza virus-specific primers is:

[0045] Upstream primer: 5′-CAT TCC ACA ACA TAC ACC C-3’19bp Tm=50.7°C,

[0046] Downstream primer: 5′-CAA CCA TCT ACC ATT CCC T-3’19bp Tm=51.7°C;

[0047] The optimal reaction concentration of H5 subtype avian influenza virus-specific primers is 0.4 μM.

[0048] 3) Design and synthesize a pair of Y-shaped double-stranded spe...

Embodiment 2

[0061] Similar to Example 1, the difference is that in step 4), in the detection solution of the fluorescent PCR reaction system of each reaction tube, MgCl 2 The optimum concentration of 3.75mM, the optimum concentration of dNTPs is 0.2mM, and the optimum dosage of Taq enzyme is 1.8U. , the optimal amount of reverse transcriptase is 0.3U. In step 5), the optimal conditions for the real-time fluorescent PCR reaction are reverse transcription at 42°C for 20 minutes to reverse transcribe the sample RNA into cDNA, pre-denature at 94°C for 3 minutes, and enter the cycle. The cycle program is denaturation at 94°C for 15 seconds and annealing at 51°C. 20s, 72°C extension for 20s, a total of 40 cycles, each cycle collects fluorescence data during the annealing stage.

Embodiment 3

[0063] Similar to Example 1, the difference lies in the real-time fluorescent PCR detection of the H5 subtype avian influenza virus with the Y-type fluorescent probe. Take 1 μl of the sample and add it to the detection solution of the detection kit, with a final volume of 20 μl. The reaction program of real-time fluorescent PCR: reverse transcription at 42°C for 20 minutes, pre-denaturation at 94°C for 3 minutes, and then cycle. Fluorescence data were collected during the annealing phase. (see Figure 2)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection method of H5 hypotype fowl influenza virus nucleic acid and agent case with simple operation, high reliability, high sensibility and short periodic time, which comprises the following steps: 1) finding conservative sequence of H5 hypotype fowl influenza virus as program target gene; 2) designing and synthesizing a couple of specificity primer with length at 18-30bp; 3) basing on the conservative sequence; designing and synthesizing a couple of Y type double chain specificity fluorescent probe; 4) constituting detecting solution of 20mul fluorescence PCR reaction system with the specificity primer of step 2 and Y type double chain specificity fluorescent probe and PCR composition; embedding into PCR reacting pipe; 5) setting positive for comparison mold and negative for comparison mold; proceeding actual time fluorescent PCR reaction; getting the testing result.

Description

technical field [0001] The invention relates to a virus, in particular to a method for detecting the H5 subtype avian influenza virus by adopting Y-type double-strand fluorescent probe technology and a kit thereof. Background technique [0002] Avian influenza (AI) is a systemic or respiratory infectious disease in birds caused by type A influenza virus. According to the pathogenicity of avian influenza virus, avian influenza can be divided into three types: highly pathogenic avian influenza (HPAI), low pathogenic avian influenza (LPAI) and non-pathogenic avian influenza (NPAI). Among them, highly pathogenic avian influenza has been stipulated as a class A severe infectious disease by my country's "Livestock and Poultry Epidemic Prevention Regulations" and the International Veterinary Bureau's Animal Epidemiological Organization (OIE). [0003] In the Hong Kong bird flu incident in 1997, the bird flu virus broke through the interspecies barrier and infected humans for the f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 陈亮于广福邵寒娟张国广窦敏曾雅明
Owner ZHANGZHOU BOXIN BIOLOGICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com