Nucleic acid detecting method for H5 hypotype fowl influenza virus and kit thereof
An avian influenza virus and detection method technology, applied in the field of viruses, can solve the problems of low sensitivity, slow identification, poor specificity, etc., and achieve the effect of good specificity and omitting cumbersome steps.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] 1) Seek the unique conserved sequence of H5 subtype avian influenza virus as the target gene to be tested. The length of the conserved sequence is 100-250bp, and the conserved sequence is:
[0043] catt ccacaacata caccctctca ccatcgggga gtgccccaaa tatgtgaaat caaacagattagtccttgcg actggactca gaaatacccc tcaaagagag agaagaagaaaaaagagagg actatttggagctatagcag gttttataga gggaggatgg cagggaatgg tagatggttg.
[0044] 2) Design and synthesize a pair of H5 subtype avian influenza virus-specific primers, the primer length is between 18-30bp, the annealing temperature is 50-60°C, and the sequence of a pair of H5 subtype avian influenza virus-specific primers is:
[0045] Upstream primer: 5′-CAT TCC ACA ACA TAC ACC C-3’19bp Tm=50.7°C,
[0046] Downstream primer: 5′-CAA CCA TCT ACC ATT CCC T-3’19bp Tm=51.7°C;
[0047] The optimal reaction concentration of H5 subtype avian influenza virus-specific primers is 0.4 μM.
[0048] 3) Design and synthesize a pair of Y-shaped double-stranded spe...
Embodiment 2
[0061] Similar to Example 1, the difference is that in step 4), in the detection solution of the fluorescent PCR reaction system of each reaction tube, MgCl 2 The optimum concentration of 3.75mM, the optimum concentration of dNTPs is 0.2mM, and the optimum dosage of Taq enzyme is 1.8U. , the optimal amount of reverse transcriptase is 0.3U. In step 5), the optimal conditions for the real-time fluorescent PCR reaction are reverse transcription at 42°C for 20 minutes to reverse transcribe the sample RNA into cDNA, pre-denature at 94°C for 3 minutes, and enter the cycle. The cycle program is denaturation at 94°C for 15 seconds and annealing at 51°C. 20s, 72°C extension for 20s, a total of 40 cycles, each cycle collects fluorescence data during the annealing stage.
Embodiment 3
[0063] Similar to Example 1, the difference lies in the real-time fluorescent PCR detection of the H5 subtype avian influenza virus with the Y-type fluorescent probe. Take 1 μl of the sample and add it to the detection solution of the detection kit, with a final volume of 20 μl. The reaction program of real-time fluorescent PCR: reverse transcription at 42°C for 20 minutes, pre-denaturation at 94°C for 3 minutes, and then cycle. Fluorescence data were collected during the annealing phase. (see Figure 2)
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com