Design method for PCR primer, uses and reagent kit thereof
A design method and a technology for designing primers, which are applied in biochemical equipment and methods, microbiological measurement/testing, etc., can solve unsolvable problems, and achieve the effects of easy design, simple operation, and easy production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0032] The design of embodiment 1.HBV primer and probe, internal control probe:
[0033] 1.1. HBV primer: LBL-HBV01: 5'-aggaa cctct atgtt tccct-3'
[0034] LBL-HBV02: 5'-ccact cccat aggaa tcttg-3'
[0035] LBL-HBV probe01: 5'FAM-tgttg ctgta caaaa ccttc gga-NFQ3'
[0036] HBV sequence available for reference (the italic bold part is the primer binding sequence):
[0037] aggaacctct atgtttccct cttgttgctg tacaaaacct tcggacggaa actgcacttg
[0038] tattcccatc ccatcatcct gggctttcgc aagattccta tgggagtgg
[0039] 1.2. Internal control probe and sequence: LBL-HBV ic probe01: 5’ROX-tgttg ctgAT cTGaa ccttc gga-NFQ3’
[0040] Synthetic internal control sequence, the internal control sequence available for reference is (the part in italics is the primer binding sequence):
[0041] aggaacctct atgtttccAt cttgttgctg ATcTGaacct tcggacggaa actgcacttgtattcccatc ccatcatcct gggctttcgT aagattccta tgggagtgg Note: capital letters in bold are designed mutation points
[0042] 1.3. Dilute the sy...
Embodiment 2
[0047] The design of embodiment 2.HCV primer and probe, internal control probe:
[0048] 2.1. HCV Primer: LBL-HCV01: 5'-cgtacagcct ccaggcc-3'
[0049] LBL-HCV02: 5'-gccgg gcata gagtg ggt-3'
[0050] LBL-HCV probe01: 5'FAM-cccct cccgg gagag ccata g-NFQ3'
[0051] HCV sequence available for reference (the part in italics is the primer binding sequence):
[0052] cgtacagcct ccaggccccc ccctcccggg agagccatag tggtctgcgg aaccggtgag
[0053] tacaccggaa ttgccgggaa gactgggtcc tttcttggat aaacccactc tatgcccggc
[0054] 2.2. Internal control probe and sequence: the internal control probe uses the same internal control probe as HBV, and the sequence is as follows:
[0055] LBL-HCV ic probe01: 5'ROX-tgttg ctgat ctgaa ccttc gga-NFQ3'
[0056] Synthesize the internal control sequence, the internal control sequence available for reference is:
[0057] cgtacagcct ccaggcT cc tgttg ctgat ctgaa ccttc gga aaacccactc aTccactctatgcccggc
[0058] Note: The uppercase bold base letters are desig...
Embodiment 3
[0064] The design of embodiment 3.HIV primer and probe, internal control probe:
[0065] 3.1. HIV primer: LBL-HIV01: 5'-aggatgtata gccctattag-3'
[0066] LBL-HIV02: 5'-gaagc ttgct cggct ct-3'
[0067] LBL-HIV probe01: 5'FAM-ttctg gacat aaaac aaggg ccaaa aga-NFQ3'
[0068] Available HIV sequences for reference (the part in italics is the primer binding sequence):
[0069] aggatgtata gccctattag cattctggac ataaaacaag ggccaaaaga atcctttaga
[0070] gactatgtag atcggttcta taaaactcta agagccgagc aagcttc
[0071] 3.2. Internal control probe and sequence: The internal control probe uses the same internal control probe as HBV, and the sequence is as follows: LBL-HIV ic probe01: 5'ROX-tgttg ctgat ctgaa ccttc gga-NFQ3'
[0072] Synthesize the internal control sequence, the internal control sequence available for reference is:
[0073] aggatgtata gccctattaT cc tgttg ctgat ctgaa ccttc gga aaacccactc Ggagccgagcaagcttc
[0074] Note: The uppercase bold base letters are designed mutatio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More