New type cell special gene HAAVmir containing microRNA combined sequence for gene treating
A technology of genes and gene fragments, applied in the field of gene therapy, to achieve the effects of ensuring effectiveness, reducing immune reactions, and clear ingredients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Construction of microRNA targeting HAAVmir gene
[0055] The sequence design of the microRNA mir-122 target box and mir-142-3p target box are perfectly complementary to the corresponding liver-specific and hematopoietic cell-specific miRNAs.
[0056] AAV type with microRNA targeting helper plasmids hsa-mir-122 and has-mir-142-3p sequences
[0057] Its sequence is: Has-mir-122 sequence: TGGAGTGTGACAATGGTGTTTG;
[0058] Has-mir-142-3p sequence: TGTAGTGTTTCCTACTTTATGGA;
[0059] The mir-122 targeting cassette is composed of oligonucleotides 5'-CCA TTG TCA CAC TCC AGT CAC AAA CAC CAT TGT CAC ACTCCA GCT AGC CAA ACA CCA TTG-3', 5'-GCA TGC TGG AGT GTG ACA ATG GTG TTT GAGCTT GGA GTG TGA CAATGG TGT TTG GCT AGC-3' annealing;
[0060] The mir-142-3p targeting cassette consists of oligonucleotides 5'-GCA TGC TCC ATA AAG TAG GAA ACA CTA CAC GAT TCCATA AAG TAG GAA ACA CTA CAA CCG-3', 5'-CCT ACT TTA TGG AGT GAT GTA GTG TTT CCTACT TTA TGGAAC CGG TTG TAG TGT TTC CTA-3' a...
Embodiment 2
[0063] Preparation of recombinant adenoviral vector containing microRNA binding sequence
[0064] The pAAV2-CMV-LacZ and AAV2-ApoE-hAAT-hFIX vectors were prepared by the previously reported three-plasmid co-transfection method ["Molecular Gene Pharmacology" edited by Xu Ruian, Chen Ling, Xiao Weidong, Peking University Press & Peking University Medical Press 2008, Beijing]. Recombinant adeno-associated virus HAAVmir, HAAVmir122 or HAAVmir142 plasmid containing microRNA binding sequence, adenovirus replication function helper plasmid, co-transfected with pAAV-CMV-LacZ vector plasmid or target gene vector such as pAAV-ApoE-hAAT-hFIX vector plasmid into HEK293 Cells (ATCC, Manassas, VA), HEK 293 strains were cultured in DMEM medium (Invitrogen, Carlsbad, CA) with 10% bovine serum (FBS, HyClone, Logan, UT); the medium contained penicillin (100U / ml) (Invitrogen , Carlsbad, CA) and streptomycin (100 μg / ml) (Invitrogen, Carlsbad, CA) at 37°C, 5% CO2 incubator. Cells are cultured ...
Embodiment 3
[0065] Example 3 >Determination of the packaging effect of microRNA-targeted HAAVmir-type helper plasmids on adenovirus vectors
[0066] In order to verify that the microRNA helper plasmid HAAVmir can still support the packaging of AAV2 vectors in 293 cells, the present invention adopts HEK293 strains to be cultivated in DMEM medium (Invitrogen, Carlsbad, CA) with 10% bovine serum (FBS, HyClone, Logan, UT); The solution contained penicillin (100 U / ml) (Invitrogen, Carlsbad, CA) and streptomycin (100 μg / ml) (Invitrogen, Carlsbad, CA) at 37°C, 5% CO2 incubator. Transfection was performed by calcium phosphate precipitation method. The helper plasmid HAAVmir was used to package the AAV2 vector, and pAAV2-CMV-lacZ was used as the reporter gene. The transfected cells were harvested 3 days later, and the adenoviral vector was ultracentrifuged twice with cesium chloride. The purity and gene titer of the vector were detected by silver staining and real time PCR (Applied Biosystems, F...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 