New type cell special gene HAAVmir containing microRNA combined sequence for gene treating

A technology of genes and gene fragments, applied in the field of gene therapy, to achieve the effects of ensuring effectiveness, reducing immune reactions, and clear ingredients

Inactive Publication Date: 2009-09-16
许瑞安 +2
View PDF0 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to systematically reduce the impact of rcAAV particles containing potential contaminating proteins and completely eliminate the research on the ability of viral capsid protein replication and synthesis from the source, so far, there have been no relevant reports at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New type cell special gene HAAVmir containing microRNA combined sequence for gene treating
  • New type cell special gene HAAVmir containing microRNA combined sequence for gene treating
  • New type cell special gene HAAVmir containing microRNA combined sequence for gene treating

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Construction of microRNA targeting HAAVmir gene

[0055] The sequence design of the microRNA mir-122 target box and mir-142-3p target box are perfectly complementary to the corresponding liver-specific and hematopoietic cell-specific miRNAs.

[0056] AAV type with microRNA targeting helper plasmids hsa-mir-122 and has-mir-142-3p sequences

[0057] Its sequence is: Has-mir-122 sequence: TGGAGTGTGACAATGGTGTTTG;

[0058] Has-mir-142-3p sequence: TGTAGTGTTTCCTACTTTATGGA;

[0059] The mir-122 targeting cassette is composed of oligonucleotides 5'-CCA TTG TCA CAC TCC AGT CAC AAA CAC CAT TGT CAC ACTCCA GCT AGC CAA ACA CCA TTG-3', 5'-GCA TGC TGG AGT GTG ACA ATG GTG TTT GAGCTT GGA GTG TGA CAATGG TGT TTG GCT AGC-3' annealing;

[0060] The mir-142-3p targeting cassette consists of oligonucleotides 5'-GCA TGC TCC ATA AAG TAG GAA ACA CTA CAC GAT TCCATA AAG TAG GAA ACA CTA CAA CCG-3', 5'-CCT ACT TTA TGG AGT GAT GTA GTG TTT CCTACT TTA TGGAAC CGG TTG TAG TGT TTC CTA-3' a...

Embodiment 2

[0063] Preparation of recombinant adenoviral vector containing microRNA binding sequence

[0064] The pAAV2-CMV-LacZ and AAV2-ApoE-hAAT-hFIX vectors were prepared by the previously reported three-plasmid co-transfection method ["Molecular Gene Pharmacology" edited by Xu Ruian, Chen Ling, Xiao Weidong, Peking University Press & Peking University Medical Press 2008, Beijing]. Recombinant adeno-associated virus HAAVmir, HAAVmir122 or HAAVmir142 plasmid containing microRNA binding sequence, adenovirus replication function helper plasmid, co-transfected with pAAV-CMV-LacZ vector plasmid or target gene vector such as pAAV-ApoE-hAAT-hFIX vector plasmid into HEK293 Cells (ATCC, Manassas, VA), HEK 293 strains were cultured in DMEM medium (Invitrogen, Carlsbad, CA) with 10% bovine serum (FBS, HyClone, Logan, UT); the medium contained penicillin (100U / ml) (Invitrogen , Carlsbad, CA) and streptomycin (100 μg / ml) (Invitrogen, Carlsbad, CA) at 37°C, 5% CO2 incubator. Cells are cultured ...

Embodiment 3

[0065] Example 3 >Determination of the packaging effect of microRNA-targeted HAAVmir-type helper plasmids on adenovirus vectors

[0066] In order to verify that the microRNA helper plasmid HAAVmir can still support the packaging of AAV2 vectors in 293 cells, the present invention adopts HEK293 strains to be cultivated in DMEM medium (Invitrogen, Carlsbad, CA) with 10% bovine serum (FBS, HyClone, Logan, UT); The solution contained penicillin (100 U / ml) (Invitrogen, Carlsbad, CA) and streptomycin (100 μg / ml) (Invitrogen, Carlsbad, CA) at 37°C, 5% CO2 incubator. Transfection was performed by calcium phosphate precipitation method. The helper plasmid HAAVmir was used to package the AAV2 vector, and pAAV2-CMV-lacZ was used as the reporter gene. The transfected cells were harvested 3 days later, and the adenoviral vector was ultracentrifuged twice with cesium chloride. The purity and gene titer of the vector were detected by silver staining and real time PCR (Applied Biosystems, F...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the molecular medicine and gene treating field, in particularly, a gene segment which is new, cell target special, and can eliminate replication ability and synthesizing ability of nucleocapsid protein from source and clean the pollution protein. The gene segment is composed of a recombinant aden-associated virus vector helper plasmid non-structure and/or structure gene, and at least one copy cell special microRNA target sequence which can be used in multiple cell strains directly, and also can be used for constructing recombinant aden-associated virus plasmid and vector to prepare medicine, basic medicine and clinic gene treating.

Description

Technical field: [0001] The present invention relates to the field of gene therapy, in particular, to a novel, cell targeting-specific gene fragment that completely eliminates the ability of virus capsid protein replication and synthesis from the source and removes its contaminating protein, and its basic and clinical applications. Medical application. Background technique: [0002] At present, the vectors used in clinical trials of gene therapy are still mostly viral vectors, accounting for more than 75%. Among them, adenovirus (adenovirus) and retrovirus (retrovirus) vectors accounted for the majority [Xu Rui'an et al., "Molecular Gene Pharmacology", Peking University Press & Peking University Medical Press, 2008, Beijing]. Virus is the smallest and simplest parasitic form of life without cell structure that has survived the long process of natural evolution. During thousands of years of natural evolution, it can find the most effective way to enter the human body. Vira...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/33C12N15/34C12N15/48C12N15/86C12N15/861C12N15/867A61K48/00C12R1/93
Inventor 许瑞安肖卫东陆晖
Owner 许瑞安
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap