Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenosis construct and application thereof in preparing space-time adjustable liver damage model

A technology for liver injury and construction, applied to cells modified by introducing foreign genetic material, using vectors to introduce foreign genetic material, animal husbandry, etc.

Inactive Publication Date: 2010-03-31
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the core of hepatocyte transplantation research is still the source of hepatocytes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model
  • Transgenosis construct and application thereof in preparing space-time adjustable liver damage model

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0070] Preparation of animal models

[0071] After obtaining the transgenic construct, the linearized construct can be transferred into fertilized eggs by conventional methods. After the offspring animals are born, various methods known in the art (including but not limited to PCR detection, Southern blotting, etc.) can be used to identify whether the transgene construct is integrated into their genomes, so as to obtain transgenic animals.

[0072]Therefore, the present invention also provides a method for preparing a spatiotemporal adjustable liver injury model, the method comprising: (1) introducing the construct 1 according to claim 1 into fertilized eggs of non-human mammals; The fertilized eggs with the construct are transferred into the fallopian tubes of pseudopregnant non-human mammals to continue to develop to generate non-human mammals with the construct 1 described in claim 1 integrated in the genome; (2) claim The construct 2 described in 1 is introduced into a fe...

Embodiment 1

[0099] Example 1. Determination of genes most suitable for inducing apoptosis of hepatocytes

[0100] It is known that many genes can induce apoptosis, and in this example, the most suitable gene for inducing apoptosis of hepatocytes is selected first.

[0101] Using the conventional FACS method, the three genes Caspase 8, Bax, tBid were compared for their ability to induce hepatic cell apoptosis, and the most suitable gene was determined. Caspase 8, Bax, and tBid were respectively cloned into the vector pcDNA3.1 (purchased from Invitrogen). Using mouse liver cDNA as a template, the primer sequences are respectively (the upstream primer sets the Eco RI site, and the downstream primer sets the XhoI site):

[0102] Caspase 8F (SEQ ID NO: 2):

[0103] CTCT GAATTC CCATGGATTTCCAGAGTTGTCTTTTATGC;

[0104] Caspase 8R (SEQ ID NO: 3):

[0105] GCAC CTCGAG TTAGGGAGGGAAGAAGAGCTTCTT;

[0106] Bax F (SEQ ID NO: 4):

[0107] GCAG GAATTC CCATGGACGGGTCCGGGGAG;

[0108] Bax R (SEQ...

Embodiment 2

[0116] Example 2. Construction of transgenic vector

[0117] The tBid and Bax genes were amplified from mouse liver cDNA by PCR and connected to pMD18T-simple vector.

[0118] The primer sequences are as follows:

[0119] tBid F (SEQ ID NO: 8):

[0120] 5'-ATATAGATCTACCATGGGCAGCCAGGCCA-3';

[0121] tBid R (SEQ ID NO: 7):

[0122] 5'-GCGCCTCGAGTCAGTCCATCTCGTTTCTAACCAAG-3';

[0123] Bax F (SEQ ID NO: 9):

[0124] 5'-ATATAGATCTACCATGGACGGGTCCGGG-3';

[0125] Bax R (SEQ ID NO: 5):

[0126] 5'-GTGGCTCGAGTCAGCCCATCTTTCTTCCAGATGG-3'.

[0127] The PCR amplification conditions were as follows:

[0128] tBid: first 94°C, 5min; then 94°C, 30s; 56°C, 30s; 72°C, 30s; 30 cycles; finally 72°C, 10min.

[0129] Bax: first 94°C, 5min; then 94°C, 30s; 58°C, 30s; 72°C, 30s; 30 cycles; finally 72°C, 10min.

[0130]Cut the IRES sequence from pIRES2-EGFP with BglII and NcoI, and connect it to the corresponding site in pET28a to obtain pET28a-IRES; then use PCR to amplify Bax and tBid from ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a transgenosis construct and an application thereof in preparing a space-time adjustable liver damage model and discloses a construct combination used for preparing the space-time adjustable liver damage model. The construct combination comprises a construct expressing space-time adjustable liver damage induction induced gene and a construct expressing Cre recombinant enzyme. The invention also discloses cells containing the construct and a method for preparing the space-time adjustable liver damage model. The obtained animal model can efficiently induce the liver damage at any time, and provides an effective way for the research of hepatic cell transplantation and liver replantation.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a transgene construct and its application in preparing a space-time adjustable liver injury model. Background technique [0002] Liver organ transplantation is currently the main means of clinical treatment of acute liver failure, end-stage liver disease and metabolic liver disease. However, due to the shortage of donor livers, the clinical application of liver transplantation has been severely limited. About 14,000 people in the United States wait for liver transplantation every year, 50% of them wait for more than one year, and about 1,300 people die each year because they cannot wait for liver transplantation. The waiting list for organ transplants in my country is also increasing. Therefore, there is an urgent need for other methods to improve liver function and prolong the survival time of patients to wait for liver transplantation, or to replace liver transplantati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N5/10A01K67/027
Inventor 王欣胡晓
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com