Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for knocking out torulopsis glabrata mitochondrion gene

A technology of Togus glabrata and mitochondrial genes, applied in the field of microbial genetic engineering, to achieve the effect of simple knockout method, easy identification and protection, and keeping the original characteristics unchanged

Inactive Publication Date: 2010-09-15
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are few institutions in China to study the molecular biology of Toructus glabrata, and it is still in the preliminary stage of research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out torulopsis glabrata mitochondrion gene
  • Method for knocking out torulopsis glabrata mitochondrion gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 The method for knocking out the chromosomal gene ATP6 of Torulopsis glabrata

[0025] 1. Obtaining the pUC-atp6::ARG8m plasmid containing the target fragment

[0026] Use primer pairs:

[0027] Con-ATP6-F:

[0028] 5'GCggatccAATATTATTTTATTATAATAATAATTTAAATTTTAATAAGTTATAATATATATTTAAAGT ATGACACATTTAGAAAGAAG 3'

[0029] Con-ATP6-R:

[0030] 5'GCGggatccTATTAATAATAATTAATTAAAGAATATTATAATATAATTAATTTATTTGTATTATATAAA TTAAGCATATACAGCTTCG 3'

[0031] The knockout box Δatp6::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end of the primers, they are the protected bases of the restriction site (capital letters), the BamHI restriction site (lower case letters), the fragment homologous to ATP6 (capital letters) and the homology of ARG8m (underlined) sequence.

[0032] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product wa...

Embodiment 2

[0053] Example 2 The method for knocking out the chromosomal gene ATP8 of Torulopsis glabrata

[0054] 1. Obtaining the pUC-atp8::ARG8m plasmid containing the target fragment

[0055] Use primer pairs:

[0056] Con-ATP8-F:

[0057] 5'GCggatccATAATAATTTATTTATTTATTAATGTTGTATTTATATTAAATATAAAAAATATATAAAT ATGACACATTTAGAAAGAAG 3'

[0058] Con-ATP8-R:

[0059] 5'GCGggatccATAATTATATATTATTAATTATATTATATTATAATTATATATTATTATTATTAATTATAT TTAAGCATATACAGCTTCG 3'

[0060] The knockout box Δatp6::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end, the primers are the protected bases of the restriction site (capital letters), the BamHI restriction site (small letters), the fragment homologous to ATP8 (capital letters) and the homology of ARG8m (underlined). source sequence.

[0061] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product was dige...

Embodiment 3

[0082] Example 3 The method for knocking out the chromosomal gene ATP9 of Torulopsis glabrata

[0083] 1. Obtaining the pUC-atp9::ARG8m plasmid containing the target fragment

[0084] Use primer pairs:

[0085] Con-ATP9-F:

[0086] 5’GCggatccATATATATATATATATTAATTATTTAAATATAATAAAGATTATAAAAAATATAATATT ATGACACATTTAGAAAGAAG 3'

[0087] Con-ATP9-R:

[0088] 5'GCGggatccAAATATTTTATTTATTAAGAATATTATAATATTACTATATTAATAGTAAACATTATTATTA TTAAGCATATACAGCTTCG 3'

[0089] The knockout box Δatp9::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end of the primers, they are the protected bases of the restriction site (capital letters), the BamHI restriction site (small letters), the fragment homologous to ATP9 (capital letters) and the homology of ARG8m (underlined). source sequence.

[0090] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for knocking out a torulopsis glabrata mitochondrion gene and belongs to the technical field of genetic engineering. In the invention, a homologous recombination fragment having the flanking sequences of an acetyl-ornithine transaminase gene (ARG 8m) and a mitochondrion gene to be knocked out is obtained by mainly using a long terminal primer, a torulopsis glabrata mitochondrion is transferred by a gene gun, and heterogeneity of the mitochondrion is eliminated by anaerobic culture to obtain a transformant which only has the gene on the modified mitochondrion. The torulopsis glabrata obtained by the invention is easy to identify and protect; the knocking method represents a novel approach and method for the genetic engineering modification of diploid of polyploidy yeasts; and the knocking method is simple and efficient, can retain the original characteristics of the yeasts, and can knock out the mitochondrion gene within 5 to 7 days.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a Togus glabrata glabrata with mitochondrial gene deletion and a knockout method thereof. Background technique [0002] Torulopsis glabrata is a haploid yeast without a sexual reproductive stage. Torulopsis glabrata is widely used for the production of pyruvate and α-ketoglutarate. Certain strains of Torulopsis glabrata are clinically opportunistic pathogens. The genetic engineering research of Torulopsis glabrata is still in its infancy. The most commonly used genetic markers in yeast are auxotrophic markers that can accomplish complementation. [0003] At present, there are few institutions in China to study the molecular biology of Toructus glabrata, and it is still in the preliminary stage of research. Screening the auxotrophic strains of Torulopsis glabrata is one of the important basic tasks for in-depth research on it. Contents of the inventio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/63C12N1/19C12R1/645
Inventor 刘立明周景文陈坚堵国成
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com