Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

A technology of polyhydroxyalkanoate and coding gene, which is applied in the field of preparing hydroxyalkanoate homopolymer, and can solve the problems of undiscovered wild strains of microorganisms and the like

Active Publication Date: 2012-07-18
TSINGHUA UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no wild strains of microorganisms capable of synthesizing non-PHB homopolymers have been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof
  • Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof
  • Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Embodiment 1, construction and biosynthesis of mutant strain Pseudomonas putida KTOY08

[0088] 1. Construction of mutant strain Pseudomonas putida KTOY08

[0089] (1) Construction of suicide plasmid pSPK09

[0090] 1) Using the genomic DNA of Pseudomonas putida strain KT2442 as a template, under the guidance of primers P1: ATTCTAGAGCTGAACCCGGATGGC and P2: AATAAGCTTGCCGAAGCGCAGGATC, PCR amplified two connected genes, 3-ketoacyl-CoA thiolase gene (fadAx) and 3-ketoacyl-CoA thiolase gene (fadAx) -Hydroxyacyl-CoA dehydrogenase gene (fadB2x), the PCR amplification product was double-digested with restriction endonucleases XbaI and HindIII, and the digested fragment with a size of about 2.7kb was recovered.

[0091] 2) Carry out double digestion of plasmid pK18mobSacB with restriction endonucleases XbaI and HindIII, and recover a digested fragment with a size of about 5.699 kb;

[0092] 3) Ligate the recovered fragments of step 1) and step 2) with T4DNA ligase, and after t...

Embodiment 2

[0137] Example 2, construction and biosynthesis of bacterial strain Pseudomonas putida KTOY08-G

[0138] 1. Construction of engineering strain Pseudomonas putida KTOY08-G

[0139] (1) Construction of recombinant vector pKQQ01

[0140] 1) Using the genomic DNA of Pseudomonas putida KT2442 as a template, PCR amplification was carried out with primers phaG-up-1 and phaG-up-2 to obtain the 3-hydroxyacyl apolipoprotein-CoA transferase gene (3-hydroxyacyl- The upstream fragment of acylcarrier protein-coenzyme A transferase (or PhaG) (sequence 3 in the sequence listing is shown in the 1st-448th nucleotide from the 5' end); use restriction endonucleases XbaI and HindIII for PCR amplification products Carry out double enzyme digestion, and recover the enzyme-cut fragment with a size of about 400bp;

[0141]Using the genomic DNA of Pseudomonas putida KT2442 as a template, PCR amplification was carried out with primers phaG-down-1 and phaG-down-2 to obtain the gene encoding 3-hydroxyac...

Embodiment 3

[0189] Example 3, construction of strain Pseudomonas putida KTHH06 and biosynthesis of PHA

[0190] Vector pKSSE5.3 (Hein S, B, Gottschalk G, Steinbüchel A. Biosynthesis of poly(4-hydroxybutyric acid) by recombinant strains of Escherichia coli. FEMS Microbiol. Lett. 1997; 153: 411-418.) (Provided by Tsinghua University);

[0191] The vector pKSSE5.3 contains the poly-β-hydroxybutyrate synthase coding gene (phbC gene) from the Ralstonia eutropha genome; the poly-β- The nucleotide sequence of the gene encoding hydroxybutyrate synthase (phbC gene) is shown as sequence 4 in the sequence listing, which is 1767bp.

[0192] Vector pBBR1-MCS2 (Michael E. Kovach, Philip H. Elzer, D. Steven Hill et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 1995; 166: 175-176 .) (provided by Tsinghua University);

[0193] The vector pBBR1-MCS2 contains the 4-hydroxybutyryl-CoA transferase encoding gene (orfZ gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing hydroxyalkanoate homopolymer and special bacteria thereof. Recombinant pseudomonas putida is prepared by the method comprising the following steps of: depriving coding functions of 3-hydroxyfatty acyl-coenzyme A dehydrogenase coding gene and 3-ketoacyl coenzyme A thiolase coding gene in pseudomonas putida to obtain recombinant pseudomonas putida, andrecording the recombinant pseudomonas putida as recombinant pseudomonas putida I. Experiments prove that the hydroxyalkanoate homopolymer, particularly medium and long-chain hydroxyalkanoate homopolymer (C4-C14), can be obtained by using the recombinant bacteria organism to synthesize polyhydroxyalkanoate. The obtained hydroxyalkanoate homopolymer has high purity and high yield. The method of theinvention can synthesize the medium and long-chain hydroxyalkanoate homopolymer with random length, and overcomes the defect that only one 3-hydroxybutyrate (HB) homopolymer can be obtained by biosynthesis in the prior art. Therefore, the method of the invention has broad application prospect in the biosynthesis field of the hydroxyalkanoate homopolymer.

Description

technical field [0001] The invention relates to a method for preparing homopolymer of hydroxy fatty acid ester and special bacteria thereof. Background technique [0002] Polyhydroxyalkanoates (PHA) is an intracellular polyester that can be synthesized by many microorganisms. It exists in the form of granular inclusions in microbial cells and is a carbon source and energy source in bacterial cells. of reserves. Because of its physical material properties and biodegradable properties similar to plastics, it is called biodegradable plastics. Polyhydroxyalkanoate has the following structure: wherein, m=1, 2, 3 or 4, usually m=1; n represents the degree of polymerization; R is a highly variable side chain, which can be saturated or unsaturated, linear or Branched, aliphatic or aromatic groups. When R=ethyl or below, it is a short-chain PHA; when R=heptyl or above, it is a long-chain PHA; when it is between the two, it is a medium-chain PHA. [0003] [0004] Research resu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12P7/62C12R1/40
Inventor 陈国强
Owner TSINGHUA UNIV