Aldehyde dehydrogenase gene, vector, engineering bacteria and application thereof

A technology of genetically engineered bacteria and aldehyde dehydrogenase, which is applied in the field of preparation of recombinant aldehyde dehydrogenase, can solve the problems of restricting large-scale production and low activity of wild-type aldehyde dehydrogenase

Inactive Publication Date: 2010-12-22
ZHEJIANG UNIV OF TECH
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the activity of wild-type aldehyde dehydrogenase is low, which limits its large-scale production. Therefore, it is of great significance to construct genetically engineered bacteria with aldehyde dehydrogenase for industrial use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aldehyde dehydrogenase gene, vector, engineering bacteria and application thereof
  • Aldehyde dehydrogenase gene, vector, engineering bacteria and application thereof
  • Aldehyde dehydrogenase gene, vector, engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The total genomic DNA of Saccharomyces cerevisiae strain (China General Microorganism Collection and Management Center (Beijing), No. 2.1543) was extracted with a rapid nucleic acid extraction instrument, and the genomic DNA was used as a template to perform primer 1 (ATGTCACACCTTCCTATGACAGTGCC) and primer 2 ( GTCCAATTTGGCACGGACCGC) under the effect of PCR amplification. The amount of each component in the PCR reaction system (total volume 50 μL): 10×Pfu DNA Polymerase Buffer 5 μL, 10 mM dNTP mixture 1 μL (20 mM), cloning primer 1 and primer 2 each 1 μL (50 μM), genomic DNA 1 μL, Pfu DNA Polymerase 1 μL, no Nucleic acid water 40μL. Using Biorad’s PCR instrument, the PCR reaction conditions are: pre-denaturation at 94°C for 5 minutes, then enter the temperature cycle at 94°C for 30s, 55°C for 1.5min, and 72°C for 2min, a total of 35 cycles, and finally extend at 72°C for 10min, and the termination temperature is 8°C . Take 5 μL and detect it by 0.9% agarose gel electro...

Embodiment 2

[0060] Expression primer 3 and primer 4 were designed according to the analysis results of Example 1, and Sal I and Hind III restriction enzyme sites were introduced into primer 3 and primer 4 respectively. In primer 3 (GTT GTC GAC TCACACCTTCCTATGACAGTGCC, the underlined part is the Sal I restriction site) and primer 4 (GTT AAGCTT Under the trigger of GTCCAATTTGGCACGGACCGC, the underlined part is the Hind III restriction site), the high-fidelity Pyrobest DNA polymerase was used to amplify to obtain a 1488bp aldehyde dehydrogenase gene fragment (SEQ ID NO: 1), which was sequenced using Sal The amplified fragment was treated with I and Hind III restriction enzymes, and the fragment was ligated with the expression vector pET28b treated with the same restriction endonuclease by T4 DNA ligase to construct the expression vector pET28b-aldH. The constructed expression vector pET28b-aldH was electrotransformed into Escherichia coli BL21, spread on a plate and cultured at 37°C overni...

Embodiment 3

[0062] The recombinant Escherichia coli BL21 / pET28b-aldH containing the expression recombinant plasmid pET28b-aldH verified in Example 2 was cultured with LB liquid medium containing 50 μg / ml kanamycin resistance for 12 hours, and then inoculated with 1% inoculum to In fresh LB liquid medium containing 50 μg / ml kanamycin resistance, cultivate to the cell concentration OD 600 About 0.6, then add IPTG with a final concentration of 0.5mM to the LB liquid medium, induce culture for 8 hours, centrifuge at 4°C and 9000rpm for 8 minutes, and collect the bacterial cells containing the recombinant aldehyde dehydrogenase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an aldehyde dehydrogenase gene derived from saccharomyces cerevisiae strains, a recombination expression vector, engineering bacteria thereof, and applications thereof in preparing the recombination aldehyde dehydrogenase. The invention provides an aldehyde dehydrogenase gene nucleotide sequence derived from the saccharomyces cerevisiae strains, connects and constructs the gene and the expression vector into an expression recombination plasmid pET28b-aldH containing the gene, and transforms the expression recombination plasmid pET28b-aldH to colibacillus BL21 to obtain the recombination colibacillus BL21 / pET28b-aldH containing the expression recombination plasmid pET28b-aldH; and the recombination colibacillus constructed by the invention can be applied to carry out biocatalysis and transformation, thus acetaldehyde, propionaldehyde or 3-hydroxypropionaldehyde are transformed into corresponding acetic acid, propionic acid or 3-hydroxypropionic acid.

Description

(1) Technical field [0001] The invention relates to an aldehyde dehydrogenase gene derived from Saccharomyces cerevisiae bacterial strain, a recombinant expression vector thereof, a genetically engineered bacterium, and an application thereof in preparing the recombinant aldehyde dehydrogenase. (2) Background technology [0002] Aldehyde dehydrogenase can catalyze 3-hydroxypropanal, propionaldehyde and acetaldehyde to generate 3-hydroxypropionic acid, propionic acid and acetic acid, respectively, and plays an important role in the chemical industry and human acetaldehyde metabolism. Aldehyde dehydrogenase is widely found in plants, animals and microorganisms, and its microbial sources mainly include Saccharomyces cerevisiae and Escherichia coli. Aldehyde dehydrogenase is a complex containing three subunits with molecular weights of 54KD, 49KD and 12KD. [0003] At present, aldehyde dehydrogenase genes from different sources have been cloned and sequenced, and the expression...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N15/63C12N9/04C12N1/15C12N1/19C12N1/21C12P7/54C12P7/40C12P7/42
Inventor郑裕国柳志强平立英沈寅初
OwnerZHEJIANG UNIV OF TECH