Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof

A hydroxypropionic acid copolymer and hydroxypropionic acid technology, applied in the field of genetic engineering bacteria, can solve problems such as complex production process, and achieve the effects of simple production process, low cost and broad application prospects

Active Publication Date: 2011-09-07
TSINGHUA UNIV
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is the first report on the synthesis of homopolymeric P(3HP) using glycerol as a precursor by microbial methods. The final accumulated P(3HP) accounts for only 12% of the dry weight of cells, and requires a two-step culture method, and the production process is relatively complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof
  • Recombinant strain for producing 3-hydracrylic acid homopolymer and/or 3-hydracrylic acid copolymer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1. Construction of expression engineering bacteria

[0059] 1. Construction of expression vector pZQ03

[0060] 1) Extract the genome of Ralstonia eutropha H16 (ATCC number: 17699, available from the American Type Culture Collection), using the R.eutrophaH16 genome as a template, and using P Re Sense and P Re Antisense is the primer, PCR reaction is carried out with pfu enzyme to amplify the target promoter P Re , And design and introduce restriction sites at both ends of the fragment.

[0061] P Re Sense: 5’ATAA GTCGAC CTCCTATTTGATTGTCTCTCTGCCGTC 3’ (sequence 6)

[0062] SalI

[0063] P Re Antisense: 5’TTAA GGGCCC GATGCGAGCGCTGCATACCGTC 3’ (sequence 7)

[0064] ApaI

[0065] PCR reaction conditions:

[0066] First denature at 94°C for 8min; then denature at 94°C for 30sec, anneal at 60°C for 30sec, extend at 72°C for 1min24sec, 29 cycles; then extend at 72°C for 10min.

[0067] PCR amplification target fragment (20μL system)

[0068] Template DNA 0.4μL

[0069] Primer 1...

Embodiment 2

[0113] Example 2. Experiments for producing 3-hydroxypropionic acid homopolymer P(3HP) with expression engineering bacteria

[0114] 1. Shake flask culture exploration test

[0115] 1. Use LB as a medium to produce 3-hydroxypropionic acid homopolymer P(3HP)

[0116] Expression engineered bacteria E.coliTrans1-T1 (pZQ01, pZQ03), E.coliTrans5α (pZQ01, pZQ03) and E.coliS17-1 (pZQ01, pZQ03) were cultured in LB medium at 37℃, 200rpm overnight; then press 5 % Inoculum amount (v / v), respectively inoculate to 100mL LB medium containing 1,3-propanediol (1,3-PDO) (containing: 5g / L yeast extract, 10g / L peptone, 10g / L NaCl, 10g / L 1,3-PDO, the rest is water, pH 7.0-7.2), 37°C, 200 rpm, shake flask culture for 48 hours to obtain a bacterial solution. Each strain is set in three parallel groups. Use nuclear magnetic resonance spectrometer NMR (JEOL, ECA-600SCC) and gas chromatograph (GC, Hewlett-Packard model 6890) to verify the accumulation of homopolymers in cells; use gas chromatograph to qua...

Embodiment 3

[0171] Example 3. Shaking flask experiment for producing P(3HP-co-4HB) copolymer with expression engineering strain E.coli S17-1 (pZQ01, pZQ03)

[0172] Expression engineered bacteria E.coliS17-1 (pZQ01, pZQ03) were cultured in LB, LB' and TB medium at 37°C and 200 rpm overnight; then inoculated to 100 mL at 5% inoculum (v / v) Culture of LB, LB' and TB with different concentrations of 1,3-propanediol (1,3-PDO, see Table 4) and / or different concentrations of 1,4-butanediol (1,4-BD, see Table 4) Base, 37 ℃, 200 rpm, shake flask culture for 48 hours, each strain set three groups in parallel.

[0173] Using the conditions in the above gas phase detection method, the standard samples are prepared as follows:

[0174] Preparation of the standard sample of the copolymer of 3-hydroxypropionic acid and 4-hydroxybutyric acid: Take about 30ul of 30% (volume concentration) 3HP (Tokyo Chemical Industry Co., Ltd. (TCI), catalog number H0297) aqueous solution in the ester Add 2ml of chloroform and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant strain for producing a 3-hydracrylic acid homopolymer and / or a 3-hydracrylic acid copolymer and an application thereof. The construction method of the recombinant strain comprises the following steps: leading 1,3-Propanediol dehydrogenase coded genes, aldehyde dehydrogenase coded genes, 3-hydracrylic acid coenzyme A ligase coded genes and PHA (Polyhydroxyalkanoates) polymerase coded genes into a starting strain to obtain the recombinant strain. The experiments in the invention prove that the engineering bacteria can efficiently express 3-hydracrylic acid coenzyme A ligase coded genes and PHA polymerase coded genes and enable the 3-hydracrylic acid to be finally polymerized into 3-hydracrylic acid homopolymer (P(3HP)) from the 3-hydracrylic acid coenzyme A. Minitype fermentation tank experiments show that the engineering bacteria provided by the invention can have a maximum P (3HP) output of 8.9g / L after being fermented in a 6L fermentation tank and the P (3HP) can account for a maximum 91.5% of cell dry weight. In addition, the recombinant strain provided by the invention has the advantages of simple production process, low costs and broad application prospects.

Description

Technical field [0001] The invention relates to a genetically engineered bacteria, in particular to a recombinant bacteria producing 3-hydroxypropionic acid homopolymer and / or 3-hydroxypropionic acid copolymer and its application. Background technique [0002] Polyhydroxyalkanoates (PHAs) are a class of polymers that are accumulated in cells by many microorganisms under unbalanced growth conditions. They have excellent properties such as thermoplasticity, biocompatibility, optical activity, and piezoelectric properties. In nature, it can be completely degraded by microorganisms to produce water and carbon dioxide. It is entirely possible to replace chemical plastics that are increasingly polluting the environment, and it is also extremely valuable in medicine, pharmacy, and fine chemistry. Its structural formula is shown in formula I: [0003] [0004] According to the types of monomers, PHA is divided into two types: homopolymer (homopolymer) and copolymer: the former has only o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N15/52C12N15/54C12N15/63C12N1/21C12P7/62C12R1/19
Inventor陈国强周琴石振宇孟德川吴琼陈金春
OwnerTSINGHUA UNIV