Recombinant Escherichia coli and application of recombinant Escherichia coli in synthesizing 3-hydroxypropionic acid

A technology for recombining Escherichia coli and genes, which is applied in the field of preparation of 3-hydroxypropionic acid, can solve the problems of high price, unbalanced activities of glycerol dehydratase and aldehyde dehydrogenase, complicated construction process, etc., and achieves the effect of increasing yield

Active Publication Date: 2016-05-11
ZHEJIANG UNIV OF TECH
View PDF5 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] So far, some progress has been made in the research of constructing genetically engineered bacteria to prepare 3-HP, but there are still many problems: (1) with E. Enzyme activity, the construction process is complicated, and E. coli cannot produce the coenzyme vitamin B of glycerol dehydratase by itself 12 , needs to be additionally added in the fermentation system, because of its high price, which greatly increases the fermentation cost; (2) Various by-products will be produced during the metabolic process, which is difficult to separate and purify; (3) Glycerol dehydratase and aldehyde dehydratase in recombinant bacteria The activity of hydrogenase is unbalanced, and the coenzyme NAD + Difficulty in regeneration is also an important reason for restricting the yield of 3-HP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Escherichia coli and application of recombinant Escherichia coli in synthesizing 3-hydroxypropionic acid
  • Recombinant Escherichia coli and application of recombinant Escherichia coli in synthesizing 3-hydroxypropionic acid
  • Recombinant Escherichia coli and application of recombinant Escherichia coli in synthesizing 3-hydroxypropionic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Replacement of promoters in plasmids

[0050] Strains and plasmids: E.ciliBL21(DE3) was purchased from Transgen, and expression vectors pACYCDuet-1 and pCDFDuet-1 were purchased from Novozymes.

[0051] The replacement of the promoters of plasmids pACYCDuet-1 and pCDFDuet-1 is to replace the sequence of the T7 promoter on the plasmid with the sequence of the tac promoter through homologous recombination.

[0052] Take the construction of pACYCDuet-tac plasmid as an example. Cultivate the Escherichia coli strain containing plasmid pACYCDuet-1, then use the pACYCDuet-1 plasmid as a template, use mutation primers to mutate the T7 sequence on the plasmid template into tac, and then chemically transform the template digested with DpnI endonuclease into BL21( DE3) in competent cells. Then spread on the LB solid medium plate containing 50mg / L chloramphenicol, and PCR screen positive clones. Recombinant plasmids were extracted from positive clones for sequencing v...

Embodiment 2

[0062] 1. Cloning and expression of glycerol dehydratase and glycerol dehydratase activator in Klebsiella pneumoniae

[0063] (1) Bacterial strains and plasmids: Klebsiella pneumoniae (K. peneumoniaeDSM2026) was purchased from DSM Company of Germany, Escherichia coli E.coliBL21 (DE3) was purchased from Transgen Company, and the expression vector pACYCDuet-tac was prepared by the method in Example 1.

[0064] (2) Glycerol dehydratase gene (dhaB123) (dhaB1GeneID: 7947197; dhaB2GeneID: 7947198; dhaB3GeneID: 7947200) and glycerol dehydratase activator gene (gdrA) (gdrAGeneID: 6936977) were cloned using K. peneumoniaeDSM2026 as a template, through routine Amplified by PCR method. (the primer sequence of amplifying glycerol dehydratase gene and glycerol dehydratase activator gene is:

[0065] dhaB1-4-F-EcoR1: CCG GAATTCATGAAAAGATCAAAACGATTTGCAGTACT,

[0066] dhaB1-4-R-HindIII:GTT AAGCTT GATCTCCCACTGACCAAAGCTGG)

[0067] The amplified product was recovered by the Clean-up kit ...

Embodiment 3

[0102] Embodiment 3: Shake flask fermentation experiment of recombinant bacterial strain and recombinant bacterial strain implement the expression of SDS-PAGE target protein

[0103] The recombinant Escherichia coli constructed by the method in Example 2 was inoculated into LB solid medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate, and cultured at 37°C for 16 hours to obtain activated recombinant Escherichia coli.

[0104] The activated recombinant Escherichia coli was inoculated into LB medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate, and cultured at 37° C. for 10 hours to obtain seed liquid.

[0105] The seed liquid was inoculated into 50 mL of fermentation medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate according to the inoculum size of 6% volume concentration, and cultured with shaking at 37° C. and 150 rpm. When OD 600 When it reaches about 0.6, add IPTG to the fermentation broth, the final con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant Escherichia coli and application of the recombinant Escherichia coli in synthesizing 3-hydroxypropionic acid. The recombinant Escherichia coli is formed by glycerol dehydratase genes dhaB123, glycerol dehydratase reactivating factor genes gdrA, alpha-oxoglutarate semialdehyde dehydrogenase mutant coding genes TUkgsadh and glycerol-3-phosphate dehydrogenase coding genes gpdl which are guided into host bacteria. By means of the gene knockout technique, the yield of byproduct 1,3-propylene glycol is reduced, and meanwhile, cofactors NAD+ of aldehyde dehydrogenase are regenerated. Thus, the yield of the 3-hydroxypropionic acid is improved by 1.5 times.

Description

(1) Technical field [0001] The invention relates to a preparation method of 3-hydroxypropionic acid, in particular to a recombinant Escherichia coli producing 3-hydroxypropionic acid and its preparation method and application. (2) Background technology [0002] Looking at the development of the world economy, petroleum-based fossil energy has played an indispensable role. However, with the depletion of fossil energy, the soaring global oil price, and the increasingly serious environmental pollution, many countries have paid more attention to sustainable development. The development and research of renewable energy, environmental protection energy and new energy; at the same time, with the continuous advancement of human science and technology, through the continuous development of new chemical and biological methods, it will become possible to replace the traditional chemical industry with biological processing based on biological resources. Therefore, the transition from th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P7/42C12R1/19
CPCC12N9/0006C12N9/0008C12N9/88C12P7/42C12Y402/0103
Inventor牛坤郑裕国熊涛秦海彬黄建峰柳志强
OwnerZHEJIANG UNIV OF TECH