Method for screening for compounds that inhibit neurodegeneration
A technology for neurodegeneration, candidate compounds, applied in biochemical equipment and methods, nervous system cells, assay/examination of microorganisms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0313] Example 1: DR6 expression in the embryonic and adult central nervous system
[0314] An RNA in situ screen for TNF receptor superfamily expression patterns in mouse embryonic tissues was performed. More specifically, in situ hybridization experiments were performed using the mRNA Locator Kit (Ambion, catalog number 1803) following the manufacturer's protocol. The following DR6 cDNA primary sequence was used to generate riboprobes for these experiments:
[0315] GAGCAGAAACGGCTCCTTTATTACCAAAGAAAAGAAGGACACAGTGTTGCGGCAGGTCCGCCTGGACCCCTGTGACTTGCAGCCCATCTTTGATGACATG CTGCATATCCTGAACCCCGAGGAGCTGCGGGTGATTGAAGAGATTCCCCAGGCTGAGGACAAACTGGACCGCCTCTTCGAGATCATTGGGGTCAAGAGCC AAGAAGCCAGCCAGACCCTCTTGGACTCTGTGTACAGTCATCTTCCTGACCTATTGTAGAACACAGGGGCACTGCATTCTGGGAATCAACCTACTGGCGG.(SEQ ID NO:3)
[0316] In vitro synthesis of riboprobes was performed using the Maxiscript kit (Ambion, catalog #1308) according to the manufacturer's protocol.
[0317] Such as Figure 2A In developing spinal co...
Embodiment 2
[0327] Example 2: Inhibition of DR6 expression by RNA interference prevents axonal degeneration of commissural neurons in explant cultures
[0328] Commissural neurons are a group of long-projecting spinal interneurons that arise in the dorsal spinal cord between developmental stages E9.5 and E11.5. The survival of commissural neurons is thought to be dependent on trophic support from one of their intermediate targets, the floor plate of the spinal cord. This dependence occurs during a period lasting several days, when their axons extend along the floor plate, after which they develop additional nutrient requirements. The dependence of neurons on trophic support incidentally derived from their intermediate axonal targets provides a mechanism for the rapid elimination of misprojecting neurons, which may help prevent the formation of aberrant neuronal circuits during the development of the nervous system (Wang et al., Nature , 401:765-769 (1999)).
[0329] To examine the fun...
Embodiment 3
[0342] Example 3: Inhibition of DR6 receptor signaling by anti-DR6 antibodies prevents axonal degeneration of commissural neurons in explant cultures
[0343] Dorsal spinal cord survival assays were performed using anti-DR6 antibodies (as described in Example 2 above). Microscopic observation (green fluorescence channel using GFP) was used to visualize commissural axons. Dorsal spinal cord survival assays were performed according to protocols known in the art (Kennedy et al. Cell 78: 425-435 (1994); Wang et al. Nature 401:765-769 (1999)), with the modifications outlined in Example 2 above. The GFP expression plasmid construct (subcloning the GFP cDNA into the pCAGGS vector backbone commercially available from BCCM / LMBP) was injected into the neural tube of E13 rat embryos. The GFP expression plasmid was then delivered to dorsal progenitor cells by electroporation. Anti-DR6 blocking antibody or control normal mouse IgG was added to commissural explants at 40 μg / ml 24 hou...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More