Indiscriminate amplification method of double-strand cDNA and genomic DNA
A genomic, indiscriminate technology, applied in the direction of recombinant DNA technology, DNA preparation, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Expansion of mouse spinal cord double-stranded cDNA
[0036] Proceed as follows:
[0037] 1. First strand cDNA synthesis
[0038] 1. Add on ice
[0039] 5μl Total RNA (about 2μg)
[0040] 4μl 5×RT buffer (Takara)
[0041] 1 μl 10mM dNTPs (Takara)
[0042] 0.5μl I-SceIdT (50M, as OligodT primer)
[0043] 0.5μl RNase Inhibitor (40u / μl) (NEB)
[0044] 1 μl PrimeScript II (200u / μl) (Takara)
[0045] 8 μl DEPC-treated HO 2 o
[0046] The total volume is 20 μl;
[0047] The I-SceIdT sequence is as follows: GACGC TAGGGATAACAGGGTAAT TTTTTTTTTTTTTTTVN, the underlined part is the recognition site of endonuclease I-SceI;
[0048]2. Mix gently and centrifuge briefly, incubate at 42°C for 1 hour, then at 45°C for 30 minutes, then at 50°C for 10 minutes.
[0049] 2. Synthesis of double-stranded cDNA
[0050] 1. Add 20 μl of the first-strand cDNA synthesis reaction product to the following system (operated on ice):
[0051] 8μl 10×RNase H buffer (NEB)
[005...
Embodiment 2
[0087] Example 2: Amplification of a target fragment with normal GC content using the amplified mouse spinal cord double-stranded cDNA:
[0088] Primers were designed according to the sequence of the target gene Gpr178 in Genbank to amplify a 583bp fragment with a GC content of 53.69%.
[0089] The primer sequences are as follows:
[0090] Forward primer: TGCTTGGCTTCCCTGGTGGCTC
[0091] Reverse primer: ATGGGCTGGTTCAGGTGC
[0092] The composition of the PCR reaction system is as follows:
[0093] 17.25 μl H 2 o
[0094] 2.5μl 10×Taq Buffer (Fermentas)
[0095] 1.5 μl MgCl2 (25 mM, Fermentas)
[0096] 0.5μl dNTPs (10mM, NEB)
[0097] 1 μl forward primer (10 μM)
[0098] 1 μl reverse primer (10 μM)
[0099] 1 μl template cDNA
[0100] 0.25μl Taq DNA Polymerase (Fermentas)
[0101] Total volume 25 μl per tube.
[0102] The PCR conditions are as follows:
[0103] Pre-denaturation at 94°C for 4 minutes
[0104]
[0105] 72℃10min
[0106] Amplified products such as ...
Embodiment 3
[0107] Example 3: Using the amplified mouse spinal cord double-stranded cDNA to amplify genes with high GC content:
[0108] The target gene is Wnt10B, the GC content of its open reading frame (ORF) region is as high as 62.22%, the length is 1170bp, and the ORF region of Wnt10B is amplified.
[0109] The primer sequences are as follows:
[0110] Forward primer: ATGCTGGAGGAGCCCCGG
[0111] Reverse primer: TCATTTACACACATTGAC
[0112] The composition of the PCR reaction system is as follows:
[0113] 17.25 μl H 2 o
[0114] 2.5μl 10×Taq Buffer (Fermentas)
[0115] 1.5 μl MgCl2 (25 mM, Fermentas)
[0116] 0.5μl dNTPs (10mM, NEB)
[0117] 1 μl forward primer (10 μM)
[0118] 1 μl reverse primer (10 μM)
[0119] 1 μl template cDNA
[0120] 0.25μl Taq DNA Polymerase (Fermentas)
[0121] Total volume 25μl per tube
[0122] The PCR conditions are as follows:
[0123] Pre-denaturation at 94°C for 4 minutes
[0124]
[0125] 72℃10min
[0126] Amplified products such as ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 