Escherichia coli genetic engineering bacteria for producing succinic acid and construction method as well as application thereof

A technology of genetically engineered bacteria and recombinant Escherichia coli, which is applied to the field of Escherichia coli genetically engineered bacteria producing succinic acid and its construction and application, can solve the problems of low feasibility, increased cost of fermentation raw materials, increased equipment construction and operating costs, etc. question

Active Publication Date: 2011-09-07
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF3 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This process is complicated to operate, and the aerobic process will greatly increase the construction and operation costs of the equipment, so it is not feasible for...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli genetic engineering bacteria for producing succinic acid and construction method as well as application thereof
  • Escherichia coli genetic engineering bacteria for producing succinic acid and construction method as well as application thereof
  • Escherichia coli genetic engineering bacteria for producing succinic acid and construction method as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, the construction of Escherichia coli genetically engineered bacteria HX004

[0058] The construction of Escherichia coli genetically engineered bacteria HX004 is divided into the following two steps:

[0059] (1) Integration of phosphoenolpyruvate carboxykinase gene

[0060] The phosphoenolpyruvate carboxykinase gene shown in Sequence 1 in the Sequence Listing was obtained by the method of total gene synthesis, which included an artificial promoter fragment, an untranslated region fragment, and a codon-optimized succinate-producing Anaerobic Spirillum phosphoenolpyruvate carboxykinase gene fragment and a transcription termination region fragment. Gene integration uses two homologous recombination methods, with the following six steps:

[0061] The first step, with Escherichia coli K-12MG1655 (the public can obtain from Tianjin Institute of Industrial Biotechnology, the non-patent literature that has recorded Escherichia coli K-12MG1655 is Blattner et al....

Embodiment 2

[0090] Embodiment 2, the construction of Escherichia coli genetically engineered bacteria HX008

[0091] The construction of Escherichia coli genetic engineering bacterium HX008 comprises the following two steps:

[0092] (1) Before the start codon of the galactose MFS transporter gene of bacterial strain HX004, add the artificial strong promoter AP1 shown in sequence 2 in the sequence listing

[0093] The method of promoter replacement is similar to gene integration, and two homologous recombination methods are also used.

[0094] In the first step, the genomic DNA of Escherichia coli K-12 MG1655 was used as a template, and the primers galP-P-up / galP-P-down were used for PCR amplification, and the upstream and downstream start codons of the galactose MFS transporter gene were amplified. A DNA fragment of about 300 nucleotides. The primer sequences are:

[0095] galP-P-up:ATCTGCTGCACCCGATCTAC,

[0096] galP-P-down:GAACCGGCAACAAACAAAAT.

[0097] The amplification system is...

Embodiment 3

[0119] Embodiment 3, the construction of Escherichia coli genetically engineered bacteria HX014

[0120] The construction of Escherichia coli genetic engineering bacterium HX014 comprises the following three steps:

[0121] (1) Knockout of pyruvate formate lyase gene pflB in strain HX008

[0122] In the first step, the pyruvate formate lyase gene pflB of Escherichia coli K-12MG1655 is amplified by using the Escherichia coli K-12MG1655 genome DNA as a template and primers pflB-up / pflB-down. The primer sequences are:

[0123] pflB-up: TGTCCGAGCTTAATGAAAAGTT;

[0124] pflB-down: CGAGTAATAACGTCCTGCTGCT.

[0125] The amplification system is the same as the first step in step (1) of Example 1. The amplified product is the pyruvate formate lyase gene pflB, which is cloned into the pEASY-Blunt cloning vector. The cloning system is the same as the first step in step (1) of Example 1. Take 200ul bacterial liquid and spread it on the LB plate containing kanamycin. After culturing o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses escherichia coli genetic engineering bacteria for producing succinic acid and a construction method as well as application thereof. The genetic engineering bacteria provided by the invention are constructed with a method comprising the following steps of: improving activity of phosphoenol pyruvate carboxykinase and suppressing activity of phosphoenol pyruvate-sugar phosphotransferase in starting escherichia coli to obtain recombinant escherichia coli which is remarked as recombinant escherichia coli I; performing a series of genetic engineering operations on the basis to construct recombinant escherichia coli II, recombinant escherichia coli III and recombinant escherichia coli IV so as to obtain genetic engineering bacteria HX004, HX008, HX014 and HX018; and performing passage domestication on the genetic engineering bacteria to obtain a genetic engineering bacteria strain XZT124. 84g/L succinic acid can be produced by fermenting 94g/L saccharic raw material through the constructed escherichia coli genetic engineering bacteria strain XZT124 by using an inorganic salt culture medium under an anaerobic condition; and the strain is suitable for industrial production of the succinic acid.

Description

technical field [0001] The invention relates to an Escherichia coli genetically engineered bacterium producing succinic acid, a construction method and application thereof. Background technique [0002] Succinic acid is an excellent platform compound, which has a wide range of applications in the fields of chemical industry, materials, medicine and food. Succinic acid is listed by the U.S. Department of Energy as one of the 12 most valuable platform compounds in the future, which can be derived from many downstream products, such as 1,4-butanediol, tetrahydrofuran, γ-butyrolactone, N-methyl Pyrrolidone, 2-pyrrolidone. PBS (polybutylene succinate) obtained by the polymerization of succinic acid and 1,4-butanediol is a fully biodegradable plastic with excellent performance. The future market potential of succinic acid will exceed 2.7 million tons per year. About 250 chemical products that can be produced from benzene can be produced from succinic acid. Once the large-scale...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/09C12P7/46C12R1/19
Inventor 张学礼徐洪涛李清艳
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap